Incidental Mutation 'R2026:Tedc2'
ID220709
Institutional Source Beutler Lab
Gene Symbol Tedc2
Ensembl Gene ENSMUSG00000024118
Gene Nametubulin epsilon and delta complex 2
Synonyms1600002H07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R2026 (G1)
Quality Score211
Status Not validated
Chromosome17
Chromosomal Location24215054-24220851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24216317 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 366 (E366V)
Ref Sequence ENSEMBL: ENSMUSP00000024930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024930]
Predicted Effect probably damaging
Transcript: ENSMUST00000024930
AA Change: E366V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024930
Gene: ENSMUSG00000024118
AA Change: E366V

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
low complexity region 78 84 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
Pfam:DUF4693 150 434 8.6e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124557
SMART Domains Protein: ENSMUSP00000119405
Gene: ENSMUSG00000024118

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171563
Meta Mutation Damage Score 0.4034 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,153,466 K269R probably benign Het
Abcc12 A G 8: 86,558,233 V251A probably benign Het
Avil G A 10: 127,011,873 G556S probably damaging Het
C3 T C 17: 57,218,562 Y898C probably damaging Het
Cacng2 A G 15: 77,995,520 F201L possibly damaging Het
Casp7 T A 19: 56,436,398 I183N probably damaging Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Ctrb1 T C 8: 111,688,685 N119S probably benign Het
Cyp3a59 G A 5: 146,096,288 V157M probably damaging Het
Dhfr G T 13: 92,365,771 G117* probably null Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dlg2 C A 7: 91,965,723 P290Q probably damaging Het
Dnah3 T A 7: 120,039,406 Q1240L probably damaging Het
Exd1 A T 2: 119,520,305 S492T probably benign Het
Fermt1 T C 2: 132,918,525 I415M probably benign Het
Fsip2 A G 2: 82,989,444 T5174A possibly damaging Het
Fuca2 T G 10: 13,512,647 V389G probably damaging Het
Gm14412 A T 2: 177,317,105 H50Q possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5129 G A 5: 29,735,734 probably benign Het
Hif3a T C 7: 17,044,397 R437G possibly damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hs1bp3 A G 12: 8,337,738 E301G probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ice2 T C 9: 69,416,325 S701P probably benign Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Man2b1 G C 8: 85,095,335 W726C probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Msh6 C T 17: 87,990,343 H1264Y probably damaging Het
Ncoa1 A T 12: 4,267,647 S1228R probably benign Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nutm2 A G 13: 50,474,820 H640R probably benign Het
Olfr1133 G T 2: 87,645,409 A238E probably damaging Het
Olfr1487 T A 19: 13,619,581 C140S probably damaging Het
Olfr266 T C 3: 106,821,711 I283V probably benign Het
Olfr31 T C 14: 14,328,891 V260A probably benign Het
Olfr616 T A 7: 103,564,877 Y134F probably damaging Het
Olfr801 T A 10: 129,670,465 D18V probably damaging Het
Pde1c C T 6: 56,180,190 V162I probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pfas C T 11: 68,993,957 G473E probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Polq A G 16: 37,062,745 D1757G possibly damaging Het
Popdc3 T C 10: 45,314,855 W21R probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rfc1 G T 5: 65,288,029 T412K probably damaging Het
Sap130 T C 18: 31,698,574 S706P possibly damaging Het
Scgn T C 13: 23,991,064 probably benign Het
Smad7 T C 18: 75,394,154 V357A probably damaging Het
Snrnp48 G T 13: 38,209,886 A56S possibly damaging Het
Sptbn1 G T 11: 30,104,559 A2178E probably benign Het
Syn2 C T 6: 115,278,251 T508I probably benign Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Trpm7 T C 2: 126,812,738 K1427E probably benign Het
Trrap A G 5: 144,803,044 I1118V possibly damaging Het
Tslp A T 18: 32,815,672 I37L probably benign Het
Ttll3 G A 6: 113,398,770 V297M probably damaging Het
Ttn T C 2: 76,710,369 D34091G possibly damaging Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 11,134,474 probably benign Het
Ube3a T C 7: 59,303,726 F803L probably damaging Het
Ubn1 A G 16: 5,064,650 E325G probably damaging Het
Wfikkn2 A G 11: 94,238,953 W121R possibly damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp616 A T 11: 74,083,587 L227F possibly damaging Het
Other mutations in Tedc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Tedc2 APN 17 24217952 missense probably benign 0.01
IGL02111:Tedc2 APN 17 24218166 splice site probably benign
IGL02347:Tedc2 APN 17 24220610 missense probably damaging 1.00
IGL03400:Tedc2 APN 17 24219803 missense probably benign
R0766:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R0766:Tedc2 UTSW 17 24216318 nonsense probably null
R1066:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1066:Tedc2 UTSW 17 24216318 nonsense probably null
R1067:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1067:Tedc2 UTSW 17 24216318 nonsense probably null
R1085:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1085:Tedc2 UTSW 17 24216318 nonsense probably null
R1086:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1086:Tedc2 UTSW 17 24216318 nonsense probably null
R1136:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1136:Tedc2 UTSW 17 24216318 nonsense probably null
R1137:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1137:Tedc2 UTSW 17 24216318 nonsense probably null
R1203:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1203:Tedc2 UTSW 17 24216318 nonsense probably null
R1345:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1345:Tedc2 UTSW 17 24216318 nonsense probably null
R1385:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1385:Tedc2 UTSW 17 24216318 nonsense probably null
R1396:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1396:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1891:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1891:Tedc2 UTSW 17 24216318 nonsense probably null
R1943:Tedc2 UTSW 17 24217949 missense possibly damaging 0.90
R1984:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1984:Tedc2 UTSW 17 24216318 nonsense probably null
R1985:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1985:Tedc2 UTSW 17 24216318 nonsense probably null
R1986:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1986:Tedc2 UTSW 17 24216318 nonsense probably null
R2026:Tedc2 UTSW 17 24216318 nonsense probably null
R2054:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R2054:Tedc2 UTSW 17 24216318 nonsense probably null
R2086:Tedc2 UTSW 17 24217900 missense probably damaging 1.00
R2317:Tedc2 UTSW 17 24216384 missense probably benign 0.00
R3705:Tedc2 UTSW 17 24216387 missense probably benign 0.30
R4085:Tedc2 UTSW 17 24219839 missense probably benign 0.01
R4664:Tedc2 UTSW 17 24220140 splice site probably benign
R4676:Tedc2 UTSW 17 24220011 missense probably benign
R4686:Tedc2 UTSW 17 24217888 critical splice donor site probably null
R4762:Tedc2 UTSW 17 24216380 missense probably benign 0.05
R4837:Tedc2 UTSW 17 24220593 missense probably damaging 1.00
R4863:Tedc2 UTSW 17 24217936 missense probably damaging 1.00
R5936:Tedc2 UTSW 17 24216341 missense probably damaging 1.00
RF031:Tedc2 UTSW 17 24216239 critical splice donor site probably benign
Z1177:Tedc2 UTSW 17 24220571 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATCCTGGCCATGAGGATGTC -3'
(R):5'- AGAGACCTTGGTGATGGCTG -3'

Sequencing Primer
(F):5'- ATGAGGATGTCCCAGCTCACATG -3'
(R):5'- TGATGGCTGTCACCCCATGAG -3'
Posted On2014-08-25