Incidental Mutation 'R2027:Fam92a'
ID220754
Institutional Source Beutler Lab
Gene Symbol Fam92a
Ensembl Gene ENSMUSG00000028218
Gene Namefamily with sequence similarity 92, member A
Synonyms
MMRRC Submission 040035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2027 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location12153409-12172015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12171216 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 79 (D79V)
Ref Sequence ENSEMBL: ENSMUSP00000135961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087052] [ENSMUST00000108285] [ENSMUST00000177837]
Predicted Effect probably damaging
Transcript: ENSMUST00000087052
AA Change: D79V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084284
Gene: ENSMUSG00000028218
AA Change: D79V

DomainStartEndE-ValueType
Pfam:FAM92 70 284 2.2e-118 PFAM
low complexity region 333 350 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108285
AA Change: D79V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103920
Gene: ENSMUSG00000028218
AA Change: D79V

DomainStartEndE-ValueType
Pfam:FAM92 70 288 4.9e-127 PFAM
low complexity region 337 354 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126012
AA Change: D59V
SMART Domains Protein: ENSMUSP00000133923
Gene: ENSMUSG00000028218
AA Change: D59V

DomainStartEndE-ValueType
Pfam:FAM92 51 139 6.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152219
Predicted Effect probably benign
Transcript: ENSMUST00000154416
SMART Domains Protein: ENSMUSP00000120369
Gene: ENSMUSG00000028218

DomainStartEndE-ValueType
Pfam:FAM92 1 197 7.5e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177837
AA Change: D79V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135961
Gene: ENSMUSG00000028218
AA Change: D79V

DomainStartEndE-ValueType
Pfam:FAM92 70 288 4.2e-109 PFAM
low complexity region 337 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Ccdc107 T C 4: 43,495,874 V259A probably benign Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Gnl1 A G 17: 35,982,958 N274D probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Itpr1 C A 6: 108,386,853 S812Y possibly damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Myo7b A G 18: 31,984,960 V871A probably benign Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr582 A T 7: 103,041,524 H15L probably benign Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rabgef1 A G 5: 130,208,779 D231G possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Fam92a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Fam92a APN 4 12164080 splice site probably benign
R0558:Fam92a UTSW 4 12164095 missense probably damaging 0.99
R0616:Fam92a UTSW 4 12168234 nonsense probably null
R1581:Fam92a UTSW 4 12155745 synonymous probably null
R1862:Fam92a UTSW 4 12155717 missense possibly damaging 0.70
R2185:Fam92a UTSW 4 12169041 splice site probably benign
R2212:Fam92a UTSW 4 12171696 critical splice donor site probably null
R3053:Fam92a UTSW 4 12157767 splice site probably null
R4441:Fam92a UTSW 4 12157733 missense probably damaging 1.00
R4771:Fam92a UTSW 4 12155689 missense probably benign 0.03
R5290:Fam92a UTSW 4 12171195 missense probably benign 0.08
R5928:Fam92a UTSW 4 12171919 unclassified probably benign
R6529:Fam92a UTSW 4 12168978 missense probably damaging 0.98
R6909:Fam92a UTSW 4 12168309 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTGGCGATAATCTTGAAGTTTG -3'
(R):5'- TGCAAGGTTCTAGGCAGGAC -3'

Sequencing Primer
(F):5'- GTTTGGCAAACTCATCAGCAAAGTC -3'
(R):5'- TTCTAGGCAGGACCAGAGC -3'
Posted On2014-08-25