Incidental Mutation 'R1986:Epg5'
ID 220757
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Name ectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission 039998-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock # R1986 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 77938467-78035027 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 77982306 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
AlphaFold Q80TA9
Predicted Effect probably null
Transcript: ENSMUST00000044622
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,419,328 S105P probably damaging Het
2610507B11Rik A T 11: 78,274,612 H1318L probably damaging Het
9930111J21Rik2 T A 11: 49,019,292 K771N possibly damaging Het
Abcc2 A G 19: 43,829,879 E1268G probably damaging Het
Adamts4 T C 1: 171,256,675 F574L possibly damaging Het
Adamts9 A G 6: 92,796,394 V1165A probably benign Het
Agap2 A T 10: 127,083,044 K430* probably null Het
Amn G T 12: 111,274,997 G232V probably damaging Het
Ank3 A G 10: 69,867,428 E297G probably damaging Het
Arhgap45 T C 10: 80,020,696 L26P probably damaging Het
Atp10b C A 11: 43,172,768 Q177K probably benign Het
Bbs10 A T 10: 111,299,257 D77V probably damaging Het
Bpifa1 T A 2: 154,144,336 L127Q probably damaging Het
Brinp2 T C 1: 158,246,778 N591S probably damaging Het
C2cd2 A C 16: 97,870,271 V476G probably damaging Het
C7 T A 15: 5,012,012 T471S possibly damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Cadps2 A G 6: 23,323,380 F1001L probably damaging Het
Ccdc188 T C 16: 18,218,843 S216P probably damaging Het
Ccdc24 A G 4: 117,872,016 L88P probably damaging Het
Dab1 T C 4: 104,613,215 I65T probably damaging Het
Dock4 A T 12: 40,730,063 D621V probably damaging Het
Drd5 A T 5: 38,320,113 M150L probably damaging Het
Eef2k T A 7: 120,873,346 M94K possibly damaging Het
Epsti1 T C 14: 77,932,233 probably null Het
Ern2 T A 7: 122,171,529 D754V probably benign Het
Fam129c T A 8: 71,603,760 I368N possibly damaging Het
Fbxo6 A G 4: 148,146,095 Y237H probably damaging Het
Fbxw24 A G 9: 109,607,056 S303P probably damaging Het
Fpr-rs3 A T 17: 20,623,841 probably null Het
Gab1 G T 8: 80,766,381 T679K probably damaging Het
Gbp9 C A 5: 105,105,724 V42F probably damaging Het
Gbp9 A T 5: 105,105,786 V21E probably damaging Het
Gm14085 A G 2: 122,527,429 T655A probably benign Het
Gm20821 A G Y: 9,783,927 Q183R probably benign Het
Gpatch11 A T 17: 78,843,837 I226F probably benign Het
Hephl1 T G 9: 15,054,552 E1035A probably damaging Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Ifna13 A G 4: 88,644,351 V12A probably benign Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Irgm2 A G 11: 58,219,558 D37G probably benign Het
Irs1 A G 1: 82,288,765 S577P probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Krtap4-16 T C 11: 99,851,496 Q26R unknown Het
Lig1 T A 7: 13,309,142 Y837* probably null Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Map3k20 C T 2: 72,441,294 Q589* probably null Het
Masp1 T G 16: 23,483,461 M347L probably benign Het
Mgat3 A T 15: 80,212,189 I406F probably benign Het
Mmp1b T G 9: 7,368,577 D425A probably benign Het
Mss51 T C 14: 20,483,191 H404R probably benign Het
Myo15b A T 11: 115,882,875 H1911L probably benign Het
Nedd4l A G 18: 65,143,803 D102G probably damaging Het
Npc2 T C 12: 84,760,749 K112E probably benign Het
Nuggc T A 14: 65,641,921 V694E probably damaging Het
Olfm1 T G 2: 28,214,706 V157G probably benign Het
Olfr476 T C 7: 107,967,670 V91A probably benign Het
Olfr63 T C 17: 33,269,515 S264P probably benign Het
Otogl T A 10: 107,794,190 probably null Het
Ovgp1 G A 3: 105,974,935 C38Y probably damaging Het
Pisd A T 5: 32,737,328 S344T probably damaging Het
Psme4 T C 11: 30,830,352 V840A probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Rin2 T A 2: 145,878,940 M731K probably damaging Het
Scgb1b19 T C 7: 33,287,683 probably null Het
Serpina10 A G 12: 103,628,255 I235T possibly damaging Het
Setbp1 T A 18: 78,858,544 E636V probably damaging Het
Sh3d21 C T 4: 126,162,497 E101K probably damaging Het
Ski T G 4: 155,221,691 D225A probably damaging Het
Slc29a3 T C 10: 60,723,814 Y187C probably damaging Het
Sort1 T A 3: 108,345,727 D494E possibly damaging Het
Sphkap A T 1: 83,277,922 L702Q probably damaging Het
Srr A G 11: 74,908,719 I285T probably damaging Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Suds3 A T 5: 117,108,352 N112K probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tesk2 T C 4: 116,751,193 L104P probably damaging Het
Tie1 C T 4: 118,478,963 R702H probably benign Het
Tpo G T 12: 30,119,466 A90E probably damaging Het
Trim30a T C 7: 104,411,465 D368G probably damaging Het
Ugt2a2 A T 5: 87,460,579 M633K possibly damaging Het
Vars2 A G 17: 35,660,061 W626R probably damaging Het
Vmn2r10 A T 5: 109,006,254 Y61* probably null Het
Vmn2r95 T C 17: 18,451,543 V514A probably benign Het
Vwa5a T G 9: 38,737,814 probably benign Het
Zfp365 A T 10: 67,909,856 C31S probably damaging Het
Zfp397 A T 18: 23,960,051 I198F possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp593 T C 4: 134,244,895 E100G possibly damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7715:Epg5 UTSW 18 77968586 missense probably damaging 1.00
R7753:Epg5 UTSW 18 77948345 missense possibly damaging 0.92
R7981:Epg5 UTSW 18 78009714 critical splice donor site probably null
R8114:Epg5 UTSW 18 78030150 missense probably benign 0.41
R8124:Epg5 UTSW 18 77964996 missense probably benign 0.05
R8307:Epg5 UTSW 18 78022679 missense probably damaging 1.00
R8458:Epg5 UTSW 18 77948731 missense probably benign 0.00
R8751:Epg5 UTSW 18 77965008 missense probably benign 0.07
R8751:Epg5 UTSW 18 77965009 missense possibly damaging 0.65
R8751:Epg5 UTSW 18 77965010 missense probably benign 0.28
R8888:Epg5 UTSW 18 78012871 missense possibly damaging 0.76
R8971:Epg5 UTSW 18 77979219 missense probably damaging 1.00
R9045:Epg5 UTSW 18 77948799 missense probably damaging 1.00
R9291:Epg5 UTSW 18 78012850 nonsense probably null
R9327:Epg5 UTSW 18 77948220 missense probably benign 0.00
R9365:Epg5 UTSW 18 77954742 missense probably damaging 1.00
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATACATGTATATCACGTACTTTGC -3'
(R):5'- GTTCTGAGTGCTATACATACAGCTTCA -3'

Sequencing Primer
(F):5'- GGGTCACTGCTGAATTCTACCAG -3'
(R):5'- TCATCTGACTGTGAGGAAACTG -3'
Posted On 2014-08-25