Incidental Mutation 'R1971:Itih5'
ID 220784
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms 4631408O11Rik, 5430408M01Rik
MMRRC Submission 039984-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R1971 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 10158382-10261340 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 10243379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 372 (D372V)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably damaging
Transcript: ENSMUST00000026886
AA Change: D372V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: D372V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Meta Mutation Damage Score 0.6493 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,686,566 (GRCm39) I242N probably benign Het
2510009E07Rik G T 16: 21,472,048 (GRCm39) Y217* probably null Het
4931429L15Rik C T 9: 46,220,086 (GRCm39) V149M probably benign Het
Abcg8 G T 17: 85,002,587 (GRCm39) probably benign Het
Acox1 A G 11: 116,089,087 (GRCm39) F77S probably benign Het
Adgrb3 G T 1: 25,586,525 (GRCm39) H389Q probably benign Het
Ak7 A G 12: 105,692,504 (GRCm39) N186S probably damaging Het
Apobr A G 7: 126,185,397 (GRCm39) T303A probably benign Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Bcl9l T C 9: 44,419,996 (GRCm39) probably null Het
Bco2 T C 9: 50,457,284 (GRCm39) D86G probably damaging Het
Bmpr1b T A 3: 141,563,333 (GRCm39) I204F probably damaging Het
Bpifb5 C A 2: 154,072,264 (GRCm39) Q324K probably benign Het
Cacna2d2 G A 9: 107,389,205 (GRCm39) V223I probably damaging Het
Capn3 A G 2: 120,311,228 (GRCm39) D105G possibly damaging Het
Ccdc40 G T 11: 119,153,901 (GRCm39) probably null Het
Ccdc83 T A 7: 89,893,362 (GRCm39) S132C probably damaging Het
Ckap2l A G 2: 129,127,342 (GRCm39) S279P possibly damaging Het
Cldn12 C A 5: 5,558,137 (GRCm39) A97S probably benign Het
Clec2l T G 6: 38,640,309 (GRCm39) S47A probably benign Het
Csnk1d C A 11: 120,863,274 (GRCm39) R222M possibly damaging Het
Ctnna1 T A 18: 35,287,580 (GRCm39) D96E probably benign Het
D630045J12Rik T C 6: 38,145,078 (GRCm39) D1316G probably damaging Het
Ddx4 C T 13: 112,736,547 (GRCm39) V608I probably damaging Het
Dmtf1 T C 5: 9,198,989 (GRCm39) E48G probably benign Het
Dnah17 G C 11: 117,995,361 (GRCm39) Q996E probably benign Het
Dnah9 G C 11: 65,739,197 (GRCm39) N4180K probably damaging Het
Dpf3 T A 12: 83,371,809 (GRCm39) probably null Het
Drd2 T C 9: 49,318,359 (GRCm39) F434L probably damaging Het
En1 A G 1: 120,534,742 (GRCm39) T344A unknown Het
Eri3 A G 4: 117,421,964 (GRCm39) T81A probably benign Het
Fam20a T C 11: 109,576,237 (GRCm39) Y174C probably damaging Het
Fam234a G C 17: 26,435,629 (GRCm39) probably null Het
Fam76a A T 4: 132,631,294 (GRCm39) I217N probably damaging Het
Fancm T A 12: 65,148,466 (GRCm39) S694T probably benign Het
Fcgbpl1 C A 7: 27,830,937 (GRCm39) A50E possibly damaging Het
Foxo3 A G 10: 42,073,258 (GRCm39) S420P probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Gm136 T G 4: 34,755,986 (GRCm39) D9A probably benign Het
Gstt2 G T 10: 75,668,499 (GRCm39) T116N probably benign Het
Hs3st6 A G 17: 24,972,267 (GRCm39) T70A probably benign Het
Hspa14 A G 2: 3,490,804 (GRCm39) V461A possibly damaging Het
Kcna2 A T 3: 107,012,140 (GRCm39) R240S probably damaging Het
Kctd18 T C 1: 58,006,779 (GRCm39) I24V probably benign Het
Lap3 T C 5: 45,663,508 (GRCm39) probably benign Het
Lcp1 T C 14: 75,437,946 (GRCm39) S119P probably damaging Het
Lig3 G C 11: 82,686,544 (GRCm39) D642H probably benign Het
Lpin1 A T 12: 16,630,724 (GRCm39) L58H probably damaging Het
Map4k5 G T 12: 69,873,102 (GRCm39) P468Q possibly damaging Het
Med31 G A 11: 72,106,244 (GRCm39) probably benign Het
Mki67 A T 7: 135,315,688 (GRCm39) probably null Het
Mrc1 G A 2: 14,249,103 (GRCm39) probably null Het
Msh3 A G 13: 92,359,784 (GRCm39) I16T probably damaging Het
Msh3 T A 13: 92,386,328 (GRCm39) probably benign Het
Mst1r A T 9: 107,790,411 (GRCm39) I675F probably benign Het
Myb A C 10: 21,016,555 (GRCm39) S652A probably benign Het
Myh2 G T 11: 67,080,004 (GRCm39) S1099I possibly damaging Het
Myl6b A G 10: 128,330,512 (GRCm39) V181A probably damaging Het
Myt1l A T 12: 29,877,091 (GRCm39) K247N unknown Het
Nanos2 G T 7: 18,721,629 (GRCm39) V34L probably benign Het
Nav1 T C 1: 135,460,091 (GRCm39) T411A probably benign Het
Nedd9 T A 13: 41,492,424 (GRCm39) I23F probably damaging Het
Nes G A 3: 87,885,634 (GRCm39) V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 (GRCm39) F588S probably damaging Het
Numa1 C T 7: 101,658,529 (GRCm39) A1605V probably damaging Het
Ofd1 T C X: 165,210,210 (GRCm39) Y205C probably benign Het
Olr1 T C 6: 129,470,498 (GRCm39) E223G probably benign Het
Or1e30 T A 11: 73,678,616 (GRCm39) M284K probably damaging Het
Or2ag12 T A 7: 106,276,877 (GRCm39) N272I probably damaging Het
Or4c118 A T 2: 88,975,078 (GRCm39) C96* probably null Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or51l4 C T 7: 103,404,527 (GRCm39) W88* probably null Het
Pate6 T A 9: 35,700,309 (GRCm39) H92L probably benign Het
Pclo A G 5: 14,763,487 (GRCm39) T3987A unknown Het
Pik3cg A T 12: 32,242,152 (GRCm39) V986D probably damaging Het
Pitpnm1 T A 19: 4,162,450 (GRCm39) D1093E probably damaging Het
Ppp1r12b T C 1: 134,793,651 (GRCm39) D571G probably benign Het
Rfx1 A G 8: 84,822,126 (GRCm39) E875G probably damaging Het
Rnf145 T A 11: 44,439,642 (GRCm39) I146N probably damaging Het
Rttn G A 18: 89,108,557 (GRCm39) R1587H probably benign Het
Safb A G 17: 56,912,821 (GRCm39) H883R probably benign Het
Sdhb A G 4: 140,700,260 (GRCm39) D120G possibly damaging Het
Serpine3 A G 14: 62,902,533 (GRCm39) N48S probably damaging Het
Sgms1 T A 19: 32,137,357 (GRCm39) I70L probably benign Het
Slc1a7 G T 4: 107,825,782 (GRCm39) D14Y probably benign Het
Smtnl2 C T 11: 72,302,183 (GRCm39) A93T probably benign Het
Srpra T C 9: 35,124,834 (GRCm39) probably null Het
Taf6l A G 19: 8,752,866 (GRCm39) probably null Het
Tbc1d10b A T 7: 126,807,036 (GRCm39) V167E probably benign Het
Tbc1d9 G A 8: 83,976,139 (GRCm39) R566H probably damaging Het
Tenm3 A G 8: 48,689,348 (GRCm39) Y2080H probably damaging Het
Tex14 A G 11: 87,402,431 (GRCm39) N506S probably damaging Het
Thada G T 17: 84,617,470 (GRCm39) P1349T probably damaging Het
Tjp1 G T 7: 64,973,826 (GRCm39) T476K probably damaging Het
Tlr11 A T 14: 50,598,691 (GRCm39) T226S probably benign Het
Tmem131 G A 1: 36,843,680 (GRCm39) Q1394* probably null Het
Tmem161a C T 8: 70,629,559 (GRCm39) R58W probably damaging Het
Tmem219 T C 7: 126,496,422 (GRCm39) S13G probably benign Het
Trp53bp1 T C 2: 121,035,517 (GRCm39) Y47C probably damaging Het
Ttn T A 2: 76,731,922 (GRCm39) probably benign Het
Ush1g A G 11: 115,209,280 (GRCm39) S305P probably damaging Het
Usp37 A T 1: 74,479,127 (GRCm39) Y948* probably null Het
Vav1 A T 17: 57,634,697 (GRCm39) Y805F probably damaging Het
Vmn1r59 A T 7: 5,457,038 (GRCm39) Y241N probably damaging Het
Vmn2r2 T A 3: 64,034,121 (GRCm39) Y467F probably damaging Het
Vps35l A C 7: 118,374,557 (GRCm39) R352S probably damaging Het
Vps54 C A 11: 21,242,051 (GRCm39) L389I probably damaging Het
Vwa8 G T 14: 79,162,694 (GRCm39) probably benign Het
Wdr19 G T 5: 65,398,503 (GRCm39) probably benign Het
Wnt2b A T 3: 104,861,933 (GRCm39) probably benign Het
Xirp2 A G 2: 67,342,039 (GRCm39) R1427G possibly damaging Het
Ylpm1 T C 12: 85,087,560 (GRCm39) S1115P probably damaging Het
Zfp946 T A 17: 22,674,406 (GRCm39) C387S probably damaging Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10,195,100 (GRCm39) missense probably damaging 1.00
IGL02125:Itih5 APN 2 10,245,798 (GRCm39) missense probably benign
IGL02370:Itih5 APN 2 10,191,786 (GRCm39) missense probably benign 0.05
IGL03376:Itih5 APN 2 10,211,584 (GRCm39) missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10,256,162 (GRCm39) missense probably benign 0.01
R0090:Itih5 UTSW 2 10,169,495 (GRCm39) missense probably benign 0.03
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0158:Itih5 UTSW 2 10,239,803 (GRCm39) splice site probably benign
R0270:Itih5 UTSW 2 10,256,075 (GRCm39) missense probably benign 0.38
R0276:Itih5 UTSW 2 10,190,375 (GRCm39) missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0810:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0903:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0905:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0906:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R1104:Itih5 UTSW 2 10,256,323 (GRCm39) missense probably benign 0.03
R1397:Itih5 UTSW 2 10,245,618 (GRCm39) missense probably benign 0.14
R1671:Itih5 UTSW 2 10,191,782 (GRCm39) missense probably benign 0.03
R3684:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10,256,081 (GRCm39) missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10,250,355 (GRCm39) missense probably damaging 0.98
R4670:Itih5 UTSW 2 10,195,180 (GRCm39) missense probably benign 0.01
R4803:Itih5 UTSW 2 10,245,392 (GRCm39) missense probably benign
R4950:Itih5 UTSW 2 10,239,892 (GRCm39) missense probably damaging 0.98
R5020:Itih5 UTSW 2 10,245,315 (GRCm39) splice site probably null
R5735:Itih5 UTSW 2 10,245,572 (GRCm39) missense probably benign 0.00
R6454:Itih5 UTSW 2 10,245,479 (GRCm39) missense probably benign
R6662:Itih5 UTSW 2 10,253,992 (GRCm39) missense probably benign 0.13
R7019:Itih5 UTSW 2 10,195,138 (GRCm39) missense probably damaging 1.00
R7068:Itih5 UTSW 2 10,254,115 (GRCm39) missense probably damaging 0.99
R7246:Itih5 UTSW 2 10,191,873 (GRCm39) splice site probably null
R7424:Itih5 UTSW 2 10,250,448 (GRCm39) missense probably damaging 1.00
R7452:Itih5 UTSW 2 10,243,607 (GRCm39) missense probably damaging 1.00
R7597:Itih5 UTSW 2 10,254,187 (GRCm39) missense probably damaging 1.00
R8025:Itih5 UTSW 2 10,245,833 (GRCm39) missense probably benign 0.13
R8253:Itih5 UTSW 2 10,243,406 (GRCm39) missense probably benign 0.06
R8349:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8439:Itih5 UTSW 2 10,239,869 (GRCm39) missense probably benign 0.19
R8449:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8825:Itih5 UTSW 2 10,195,231 (GRCm39) missense probably benign 0.00
R9110:Itih5 UTSW 2 10,191,831 (GRCm39) missense probably benign
R9582:Itih5 UTSW 2 10,195,013 (GRCm39) missense probably benign 0.07
R9744:Itih5 UTSW 2 10,256,221 (GRCm39) missense probably damaging 1.00
X0026:Itih5 UTSW 2 10,243,370 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CCTTTGCAGGGGAGAGTTAC -3'
(R):5'- AGATCTGACCTCTGGTGGCTTC -3'

Sequencing Primer
(F):5'- CTGGTCACAGGAGAAGGTTTTTACAG -3'
(R):5'- ACCTCTGGTGGCTTCCTTGG -3'
Posted On 2014-08-25