Mutagenetix > Incidental Mutation

Incidental Mutation 'R2027:Hook3'

220800

Institutional Source

Beutler Lab

Gene Symbol

Hook3

Ensembl Gene

ENSMUSG00000037234

Gene Name

hook microtubule tethering protein 3

Synonyms

E330005F07Rik, 5830454D03Rik

MMRRC Submission

040035-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2027 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26021421-26119224 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26038098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 588 (E588G)

Ref Sequence

ENSEMBL: ENSMUSP00000046788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]

AlphaFold

Q8BUK6

Predicted Effect

probably damaging
Transcript: ENSMUST00000037182
AA Change: E588G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: E588G

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147613
AA Change: E228G

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234
AA Change: E228G

Domain	Start	End	E-Value	Type
Pfam:HOOK	1	194	1.1e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152144

Predicted Effect

probably benign
Transcript: ENSMUST00000211683

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211777

Meta Mutation Damage Score

0.0713

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,742,587	M55T	possibly damaging	Het
4932438A13Rik	T	A	3: 37,047,961		probably benign	Het
A4gnt	T	C	9: 99,620,201	V138A	possibly damaging	Het
Aatk	A	G	11: 120,009,317	S1291P	probably damaging	Het
Adgrv1	C	T	13: 81,595,182	V67M	probably damaging	Het
Apoa4	G	A	9: 46,243,000	V300M	probably damaging	Het
Bcl2a1d	A	T	9: 88,731,385	V112E	possibly damaging	Het
Cabp2	T	A	19: 4,087,126	M166K	probably damaging	Het
Camsap1	A	G	2: 25,938,526	V1062A	possibly damaging	Het
Cap1	T	G	4: 122,862,893		probably benign	Het
Caprin2	A	G	6: 148,877,887	Y141H	probably damaging	Het
Card11	T	C	5: 140,906,767	Y181C	probably damaging	Het
Ccdc107	T	C	4: 43,495,874	V259A	probably benign	Het
Chd9	A	G	8: 90,907,991		probably benign	Het
Col12a1	T	C	9: 79,645,793		probably null	Het
Cuzd1	T	C	7: 131,320,091	T61A	possibly damaging	Het
Dbp	C	A	7: 45,708,276	D89E	probably benign	Het
Dhps	A	T	8: 85,072,611	N140Y	probably damaging	Het
Dido1	A	T	2: 180,689,181	L158*	probably null	Het
Dnah9	T	G	11: 65,955,338	N2958T	probably benign	Het
Dpp8	T	A	9: 65,078,774	Y849N	probably damaging	Het
Dsg2	A	G	18: 20,583,004		probably benign	Het
Efemp1	A	T	11: 28,914,696	Y250F	possibly damaging	Het
Fam92a	T	A	4: 12,171,216	D79V	probably damaging	Het
Faxc	T	C	4: 21,958,439		probably benign	Het
Frem3	G	T	8: 80,695,337	C2122F	possibly damaging	Het
Gan	T	C	8: 117,187,499		probably null	Het
Gm11487	A	G	4: 73,403,058	I154T	possibly damaging	Het
Gnl1	A	G	17: 35,982,958	N274D	probably benign	Het
Itpr1	C	A	6: 108,386,853	S812Y	possibly damaging	Het
Kbtbd3	C	T	9: 4,317,075		probably benign	Het
Macf1	C	T	4: 123,371,918	A4821T	probably damaging	Het
Mepe	T	C	5: 104,327,091	S13P	possibly damaging	Het
Myh11	A	G	16: 14,232,668	Y478H	probably damaging	Het
Myo7b	A	G	18: 31,984,960	V871A	probably benign	Het
Nckap1	A	T	2: 80,535,518	M466K	probably damaging	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Olfr1025-ps1	A	C	2: 85,918,770	S282R	probably damaging	Het
Olfr1107	T	A	2: 87,071,553	N194Y	possibly damaging	Het
Olfr1413	A	T	1: 92,573,767	T199S	probably damaging	Het
Olfr582	A	T	7: 103,041,524	H15L	probably benign	Het
Olfr731	A	G	14: 50,237,949	I312T	probably benign	Het
Olfr825	A	G	10: 130,162,735	I197T	probably benign	Het
Otof	T	C	5: 30,421,014	T97A	probably benign	Het
Peli2	G	A	14: 48,256,145	E275K	probably benign	Het
Pik3c2a	T	C	7: 116,350,822	Y1320C	probably damaging	Het
Pkn1	A	G	8: 83,671,378	V795A	probably damaging	Het
Pramel5	A	G	4: 144,271,704	L323P	probably damaging	Het
Prr5	A	T	15: 84,701,379	R183W	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rabgef1	A	G	5: 130,208,779	D231G	possibly damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rc3h1	C	T	1: 160,954,937	P662L	probably benign	Het
Rpl7a-ps5	G	T	17: 57,839,095	Q47K	probably benign	Het
Sclt1	G	A	3: 41,730,888	T45I	probably benign	Het
Slc22a17	A	G	14: 54,908,086	I202T	probably damaging	Het
Slc25a13	A	G	6: 6,073,487	L457S	probably damaging	Het
Slc44a3	T	C	3: 121,463,410		probably benign	Het
Slc7a9	G	A	7: 35,454,137	V188M	probably damaging	Het
Tmem161a	T	A	8: 70,177,520	F119I	probably damaging	Het
Tmem240	A	G	4: 155,735,435	D32G	possibly damaging	Het
Tmtc4	T	C	14: 122,921,265	N682S	probably benign	Het
Uqcrc1	G	A	9: 108,947,015	V262M	probably benign	Het
Vmn1r87	G	A	7: 13,131,896	R155C	probably damaging	Het
Vmn2r100	A	T	17: 19,522,072	Q236L	probably benign	Het
Vmn2r97	T	A	17: 18,929,682	I444N	unknown	Het
Wisp1	A	G	15: 66,917,409	E248G	possibly damaging	Het
Yif1a	A	T	19: 5,089,872	H115L	probably damaging	Het
Zfp280b	T	C	10: 76,038,494	L69S	probably damaging	Het
Zfp579	C	A	7: 4,993,521	E464*	probably null	Het

Other mutations in Hook3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Hook3	APN	8	26059250	missense	possibly damaging	0.46
IGL01066:Hook3	APN	8	26048298	missense	probably damaging	1.00
IGL01145:Hook3	APN	8	26059344	missense	probably benign	0.00
IGL01514:Hook3	APN	8	26088189	missense	possibly damaging	0.69
IGL01727:Hook3	APN	8	26070159	missense	probably benign	0.00
IGL01832:Hook3	APN	8	26072365	missense	possibly damaging	0.87
IGL01874:Hook3	APN	8	26039732	missense	possibly damaging	0.71
IGL01931:Hook3	APN	8	26088055	splice site	probably benign
IGL01948:Hook3	APN	8	26059312	missense	possibly damaging	0.95
IGL02209:Hook3	APN	8	26070265	missense	probably damaging	0.99
IGL02675:Hook3	APN	8	26061434	missense	possibly damaging	0.64
IGL02750:Hook3	APN	8	26095754	splice site	probably benign
Rufio	UTSW	8	26034940	nonsense	probably null
R0384:Hook3	UTSW	8	26044235	splice site	probably null
R0600:Hook3	UTSW	8	26118986	missense	probably benign
R1037:Hook3	UTSW	8	26072350	missense	possibly damaging	0.92
R1413:Hook3	UTSW	8	26038106	missense	probably damaging	0.98
R1563:Hook3	UTSW	8	26110752	missense	probably benign	0.06
R1767:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R1806:Hook3	UTSW	8	26068659	missense	probably damaging	1.00
R2025:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2026:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2091:Hook3	UTSW	8	26059394	splice site	probably benign
R2153:Hook3	UTSW	8	26070197	missense	probably damaging	1.00
R2184:Hook3	UTSW	8	26118983	missense	probably benign	0.00
R4586:Hook3	UTSW	8	26032011	missense	probably damaging	0.98
R4863:Hook3	UTSW	8	26038029	missense	probably damaging	1.00
R4971:Hook3	UTSW	8	26082579	missense	probably benign	0.22
R5023:Hook3	UTSW	8	26032019	frame shift	probably null
R5026:Hook3	UTSW	8	26110757	missense	probably damaging	0.98
R5068:Hook3	UTSW	8	26095757	critical splice donor site	probably null
R5253:Hook3	UTSW	8	26072291	missense	probably benign
R5383:Hook3	UTSW	8	26118989	missense	probably benign	0.01
R5437:Hook3	UTSW	8	26061422	missense	probably benign	0.05
R5528:Hook3	UTSW	8	26072293	missense	probably damaging	1.00
R5551:Hook3	UTSW	8	26068611	missense	possibly damaging	0.75
R5846:Hook3	UTSW	8	26044327	intron	probably benign
R5907:Hook3	UTSW	8	26044278	intron	probably benign
R6082:Hook3	UTSW	8	26110785	missense	probably benign	0.00
R6124:Hook3	UTSW	8	26059272	missense	probably benign	0.20
R6301:Hook3	UTSW	8	26034940	nonsense	probably null
R6314:Hook3	UTSW	8	26088108	missense	probably benign
R6448:Hook3	UTSW	8	26093664	missense	probably benign	0.02
R6810:Hook3	UTSW	8	26032422	splice site	probably null
R7168:Hook3	UTSW	8	26071086	missense	probably benign	0.02
R7856:Hook3	UTSW	8	26035221	missense	probably damaging	1.00
R7988:Hook3	UTSW	8	26073647	missense	probably benign	0.02
R8079:Hook3	UTSW	8	26088058	critical splice donor site	probably null
R9121:Hook3	UTSW	8	26035167	missense	probably damaging	1.00
R9223:Hook3	UTSW	8	26032524	missense
R9244:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R9246:Hook3	UTSW	8	26072291	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTTAGAAGGCTTCTTTGATGA -3'
(R):5'- CACCTGGAGCTGCTTCTG -3'

Sequencing Primer
(F):5'- CTTAGAAGGCTTCTTTGATGATTTTC -3'
(R):5'- CTGAAGGCAGCTACAGTGTACTTAC -3'

Posted On

2014-08-25