Incidental Mutation 'R2027:Myo7b'
ID220877
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
MMRRC Submission 040035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2027 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31984960 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 871 (V871A)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: V871A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: V871A

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Ccdc107 T C 4: 43,495,874 V259A probably benign Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably benign Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Fam92a T A 4: 12,171,216 D79V probably damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Gnl1 A G 17: 35,982,958 N274D probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Itpr1 C A 6: 108,386,853 S812Y possibly damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr582 A T 7: 103,041,524 H15L probably benign Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rabgef1 A G 5: 130,208,779 D231G possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGATATAATGGACTCTTGCTG -3'
(R):5'- GATCCTAGTGGGCTTTGAACGC -3'

Sequencing Primer
(F):5'- TGGACTCTTGCTGTATTTCTAAAAAC -3'
(R):5'- GGCTTTGAACGCCTGCAG -3'
Posted On2014-08-25