Incidental Mutation 'R2029:Skint1'
ID220919
Institutional Source Beutler Lab
Gene Symbol Skint1
Ensembl Gene ENSMUSG00000089773
Gene Nameselection and upkeep of intraepithelial T cells 1
Synonyms
MMRRC Submission 040036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R2029 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112006269-112029538 bp(+) (GRCm38)
Type of Mutationunclassified (2050 bp from exon)
DNA Base Change (assembly) G to A at 112021456 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117379] [ENSMUST00000161389] [ENSMUST00000162158] [ENSMUST00000162885]
Predicted Effect probably benign
Transcript: ENSMUST00000117379
AA Change: R195K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124545
Gene: ENSMUSG00000089773
AA Change: R195K

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Pfam:C2-set_2 142 228 2.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161389
AA Change: R195K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125313
Gene: ENSMUSG00000089773
AA Change: R195K

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Pfam:C2-set_2 142 228 3.1e-6 PFAM
transmembrane domain 248 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162158
AA Change: R195K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124737
Gene: ENSMUSG00000089773
AA Change: R195K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGv 44 125 1.88e-8 SMART
transmembrane domain 247 269 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162885
SMART Domains Protein: ENSMUSP00000125625
Gene: ENSMUSG00000089773

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (97/99)
MGI Phenotype PHENOTYPE: Mice homozygous for a point mutation allele exhibit impaired T cell differentiation with reduced Vgamma5+Vdelta1+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,067,624 S68* probably null Het
9130409I23Rik T A 1: 181,054,931 I86K probably benign Het
Adam18 C G 8: 24,650,877 G286A probably damaging Het
Adcy1 G A 11: 7,139,142 A519T probably benign Het
AI314180 G A 4: 58,844,165 R534* probably null Het
Anxa2 T A 9: 69,464,480 S2T possibly damaging Het
Ap3m1 G A 14: 21,039,149 S261L possibly damaging Het
Asna1 A T 8: 85,019,774 Y148* probably null Het
Baz2b A T 2: 59,912,723 probably benign Het
Brdt T A 5: 107,359,224 S497T probably benign Het
Cdh11 A G 8: 102,679,772 F23S probably benign Het
Cdh16 A C 8: 104,617,802 L540R probably damaging Het
Ces5a A T 8: 93,534,577 L74Q probably damaging Het
Cfap69 A G 5: 5,604,306 S543P probably damaging Het
Cfap74 T C 4: 155,442,081 I763T possibly damaging Het
Cma1 T A 14: 55,943,734 R58S possibly damaging Het
Csmd3 C T 15: 47,838,579 D1599N probably damaging Het
Cyld A G 8: 88,745,312 K857R probably benign Het
Cyp3a16 T C 5: 145,451,857 D270G probably damaging Het
D1Pas1 T C 1: 186,968,089 S72P possibly damaging Het
Ddx3y T C Y: 1,266,389 E331G probably benign Het
Dis3l2 T C 1: 86,854,467 probably benign Het
Dopey1 G T 9: 86,521,365 W1539C probably damaging Het
Dopey2 A G 16: 93,769,435 K917E probably benign Het
Efcab3 T C 11: 105,100,025 I5462T probably damaging Het
Epo A G 5: 137,485,185 probably benign Het
Figla T A 6: 86,020,642 probably benign Het
Flvcr1 T C 1: 191,021,156 D273G probably benign Het
Fryl T A 5: 73,022,122 R304* probably null Het
Gcm1 T G 9: 78,065,044 D422E possibly damaging Het
Ggt6 A G 11: 72,437,541 D251G possibly damaging Het
Git2 A G 5: 114,766,450 probably null Het
Gm18856 A T 13: 13,964,791 probably benign Het
Gm20939 T A 17: 94,875,824 probably benign Het
Gm5039 A T 12: 88,321,421 S21T unknown Het
Gm7534 T C 4: 134,202,358 K212R possibly damaging Het
Gpr176 A G 2: 118,279,432 Y449H probably benign Het
H2-Eb1 A G 17: 34,314,392 E196G probably damaging Het
H2-M10.6 A G 17: 36,813,907 T239A possibly damaging Het
Haus5 T C 7: 30,659,400 N237S possibly damaging Het
Hectd3 T C 4: 117,000,685 M605T probably damaging Het
Hps3 T C 3: 20,030,527 I166V probably benign Het
Ighv5-21 A T 12: 114,322,814 probably benign Het
Kdm6b C T 11: 69,403,592 G1218D unknown Het
Klhl30 A G 1: 91,357,914 probably null Het
Kmt2a A T 9: 44,818,450 S3523R probably benign Het
Lnpep A T 17: 17,568,399 N481K probably damaging Het
Lrp1b T C 2: 41,341,849 H1203R probably benign Het
Lrrc8a C T 2: 30,256,649 R492W probably damaging Het
Magel2 T A 7: 62,380,594 V1082D unknown Het
Memo1 A C 17: 74,245,054 H82Q probably null Het
Myh13 A T 11: 67,361,289 T1408S probably benign Het
Myh2 A T 11: 67,194,625 N1792Y possibly damaging Het
Myo1e A T 9: 70,368,687 N728I possibly damaging Het
Myo1e T C 9: 70,378,715 probably benign Het
Myo5c T C 9: 75,289,055 probably benign Het
Olfr1205 T A 2: 88,831,405 M96K possibly damaging Het
Olfr323 T A 11: 58,625,493 L184F probably damaging Het
Olfr378 A G 11: 73,425,362 V207A probably benign Het
Olfr578 T A 7: 102,984,271 T298S probably damaging Het
Olfr594 T C 7: 103,219,760 F14S probably damaging Het
Olfr715b T C 7: 107,106,436 I142V probably benign Het
Parp2 C T 14: 50,810,086 A18V probably benign Het
Peli1 T A 11: 21,148,110 C282S probably damaging Het
Piezo2 T C 18: 63,118,935 M404V possibly damaging Het
Pkn1 T A 8: 83,677,963 Q496L possibly damaging Het
Pla2r1 A T 2: 60,431,973 F1093L probably damaging Het
Ppp2r3a A G 9: 101,145,481 V323A probably damaging Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prg2 C T 2: 84,981,998 probably benign Het
Ptprb G A 10: 116,347,053 G1545S probably benign Het
Rbm19 A G 5: 120,120,242 D174G possibly damaging Het
Rhbdf2 T A 11: 116,601,148 T526S probably damaging Het
Rpusd4 A G 9: 35,268,014 N42S probably benign Het
Ryr3 T A 2: 112,647,016 Q4455L possibly damaging Het
Sema4a G T 3: 88,451,361 H30Q probably damaging Het
Slc1a3 A G 15: 8,645,669 V284A probably benign Het
Slc30a9 A T 5: 67,339,975 K288* probably null Het
Slc36a1 G T 11: 55,228,338 A380S probably benign Het
Slc47a1 G A 11: 61,378,007 probably benign Het
Snx19 A T 9: 30,429,000 E478V probably benign Het
Spag6 T C 2: 18,734,105 probably benign Het
Stag1 A T 9: 100,786,687 T223S probably damaging Het
Terb1 A T 8: 104,498,100 probably benign Het
Terf1 A G 1: 15,805,946 D90G possibly damaging Het
Tex15 A G 8: 33,571,274 D518G probably damaging Het
Tmem174 T A 13: 98,637,038 M95L possibly damaging Het
Tnnt3 GTCCAGGCATCTC GTC 7: 142,512,627 probably benign Het
Usp28 A G 9: 48,985,503 D8G probably benign Het
Vmn2r105 T C 17: 20,224,578 T551A probably damaging Het
Vmn2r107 A G 17: 20,375,287 I701V probably benign Het
Vmn2r13 A C 5: 109,192,077 F11V probably benign Het
Vmn2r85 G C 10: 130,425,574 S298* probably null Het
Wdr6 C G 9: 108,575,355 W443S probably damaging Het
Wipi1 A G 11: 109,583,190 V210A probably damaging Het
Zfp317 A G 9: 19,645,236 T47A probably benign Het
Zfp61 T C 7: 24,292,289 T146A probably benign Het
Zfp964 A G 8: 69,663,917 E389G unknown Het
Zfyve16 T C 13: 92,504,477 D1253G probably damaging Het
Zswim7 G A 11: 62,267,473 probably benign Het
Other mutations in Skint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Skint1 APN 4 112021580 critical splice donor site probably null
IGL01890:Skint1 APN 4 112010681 missense probably damaging 1.00
IGL02020:Skint1 APN 4 112025527 missense probably benign 0.08
IGL02045:Skint1 APN 4 112025530 missense possibly damaging 0.80
R0421:Skint1 UTSW 4 112019014 missense possibly damaging 0.74
R0544:Skint1 UTSW 4 112021365 missense probably damaging 1.00
R0617:Skint1 UTSW 4 112029399 splice site probably benign
R0881:Skint1 UTSW 4 112028857 missense probably benign 0.04
R0973:Skint1 UTSW 4 112028215 splice site probably benign
R1036:Skint1 UTSW 4 112019296 missense possibly damaging 0.71
R1469:Skint1 UTSW 4 112025511 missense probably benign 0.00
R1469:Skint1 UTSW 4 112025511 missense probably benign 0.00
R2063:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2064:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2065:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2066:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2067:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2372:Skint1 UTSW 4 112019151 missense probably damaging 1.00
R2518:Skint1 UTSW 4 112025481 missense probably benign 0.25
R2971:Skint1 UTSW 4 112021330 missense possibly damaging 0.50
R4656:Skint1 UTSW 4 112021477 missense probably damaging 1.00
R4993:Skint1 UTSW 4 112028333 critical splice donor site probably null
R5083:Skint1 UTSW 4 112029433 missense probably benign 0.01
R5450:Skint1 UTSW 4 112025532 missense probably benign 0.00
R5583:Skint1 UTSW 4 112019056 missense probably damaging 1.00
R5645:Skint1 UTSW 4 112025502 missense probably benign 0.41
R5877:Skint1 UTSW 4 112021523 nonsense probably null
R5950:Skint1 UTSW 4 112019335 missense probably benign
R5974:Skint1 UTSW 4 112019319 missense probably benign 0.02
R6216:Skint1 UTSW 4 112021482 missense probably benign 0.00
R6494:Skint1 UTSW 4 112010712 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCAATTAGAGCCCTTACCTCTTTAG -3'
(R):5'- TAGAGCTTAAGCAATCAAGTCAAGG -3'

Sequencing Primer
(F):5'- GTTTTACTCTTCTGTTCCAACCAG -3'
(R):5'- GTCAAGGAAGAAAATGAATCATTCTG -3'
Posted On2014-08-25