Incidental Mutation 'R1971:Myh2'
ID220921
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 039984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R1971 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67189178 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 1099 (S1099I)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018641
AA Change: S1099I

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: S1099I

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170159
AA Change: S1099I

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: S1099I

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.0992 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bcl9l T C 9: 44,508,699 probably null Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Bpifb5 C A 2: 154,230,344 Q324K probably benign Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Mst1r A T 9: 107,913,212 I675F probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tbc1d9 G A 8: 83,249,510 R566H probably damaging Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vps54 C A 11: 21,292,051 L389I probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCCCAGGAGTCCATCATG -3'
(R):5'- TTCATCTCGATCTGGGCTGAAG -3'

Sequencing Primer
(F):5'- TCCATCATGGACATTGAAAATGAG -3'
(R):5'- GTCAGAGCGCTGCTTCTCTG -3'
Posted On2014-08-25