Incidental Mutation 'R1971:Dnah17'
ID220938
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Namedynein, axonemal, heavy chain 17
SynonymsLOC382552, Dnahcl1, 2810003K23Rik, Dnahc17
MMRRC Submission 039984-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1971 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118021723-118130634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 118104535 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 996 (Q996E)
Ref Sequence ENSEMBL: ENSMUSP00000120542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]
Predicted Effect probably benign
Transcript: ENSMUST00000084803
AA Change: Q996E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: Q996E

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106308
AA Change: Q996E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: Q996E

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132685
AA Change: Q996E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: Q996E

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Meta Mutation Damage Score 0.1051 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bcl9l T C 9: 44,508,699 probably null Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Bpifb5 C A 2: 154,230,344 Q324K probably benign Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Mst1r A T 9: 107,913,212 I675F probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tbc1d9 G A 8: 83,249,510 R566H probably damaging Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vps54 C A 11: 21,292,051 L389I probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 118088214 missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 118043173 missense probably damaging 0.97
IGL00764:Dnah17 APN 11 118096485 missense probably damaging 0.99
IGL00795:Dnah17 APN 11 118093634 missense probably benign 0.35
IGL00823:Dnah17 APN 11 118047161 missense probably benign 0.22
IGL01145:Dnah17 APN 11 118047173 missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 118049934 missense probably damaging 1.00
IGL01454:Dnah17 APN 11 118058397 missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118119568 missense probably damaging 1.00
IGL01548:Dnah17 APN 11 118098612 missense probably benign 0.21
IGL01557:Dnah17 APN 11 118073686 missense probably damaging 0.98
IGL01632:Dnah17 APN 11 118033881 missense probably damaging 1.00
IGL01636:Dnah17 APN 11 118041056 missense probably benign 0.03
IGL01672:Dnah17 APN 11 118042160 missense probably damaging 0.97
IGL01822:Dnah17 APN 11 118081993 missense probably damaging 1.00
IGL01869:Dnah17 APN 11 118052676 missense probably benign 0.09
IGL01916:Dnah17 APN 11 118125288 missense probably benign 0.00
IGL02131:Dnah17 APN 11 118072908 missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118124261 missense probably benign 0.01
IGL02220:Dnah17 APN 11 118072967 nonsense probably null
IGL02454:Dnah17 APN 11 118080767 missense probably damaging 0.98
IGL02458:Dnah17 APN 11 118036350 missense probably damaging 1.00
IGL02588:Dnah17 APN 11 118025653 missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 118073548 missense probably damaging 1.00
IGL02881:Dnah17 APN 11 118042118 missense probably damaging 1.00
IGL02952:Dnah17 APN 11 118088268 missense probably benign 0.03
IGL03382:Dnah17 APN 11 118081943 missense probably damaging 1.00
IGL03389:Dnah17 APN 11 118094979 missense probably damaging 1.00
ergos UTSW 11 118041158 splice site probably benign
watt UTSW 11 118080766 missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 118098582 missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 118060092 missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 118074434 missense possibly damaging 0.82
R0116:Dnah17 UTSW 11 118058306 missense probably benign 0.01
R0157:Dnah17 UTSW 11 118127171 missense probably benign
R0320:Dnah17 UTSW 11 118052674 missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 118098539 missense probably benign 0.10
R0382:Dnah17 UTSW 11 118128996 missense probably damaging 1.00
R0383:Dnah17 UTSW 11 118067547 missense probably benign
R0400:Dnah17 UTSW 11 118082078 missense probably damaging 1.00
R0420:Dnah17 UTSW 11 118039939 missense probably damaging 1.00
R0483:Dnah17 UTSW 11 118047124 missense probably benign
R0533:Dnah17 UTSW 11 118110537 missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 118072900 missense probably damaging 1.00
R0564:Dnah17 UTSW 11 118082981 missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118121471 missense probably benign 0.00
R0608:Dnah17 UTSW 11 118090749 nonsense probably null
R0614:Dnah17 UTSW 11 118070568 splice site probably benign
R0632:Dnah17 UTSW 11 118067682 splice site probably benign
R0831:Dnah17 UTSW 11 118060271 missense probably damaging 0.99
R0838:Dnah17 UTSW 11 118060104 missense probably damaging 1.00
R0879:Dnah17 UTSW 11 118056835 splice site probably benign
R1061:Dnah17 UTSW 11 118052688 missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 118042175 missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118127137 critical splice donor site probably null
R1297:Dnah17 UTSW 11 118121366 splice site probably benign
R1332:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118125606 splice site probably benign
R1418:Dnah17 UTSW 11 118074023 missense probably damaging 0.98
R1432:Dnah17 UTSW 11 118023327 missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118114233 missense probably damaging 1.00
R1500:Dnah17 UTSW 11 118101053 missense probably benign
R1506:Dnah17 UTSW 11 118125387 missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 118095015 missense probably benign
R1567:Dnah17 UTSW 11 118125985 missense probably damaging 1.00
R1597:Dnah17 UTSW 11 118103498 splice site probably benign
R1665:Dnah17 UTSW 11 118121495 splice site probably benign
R1703:Dnah17 UTSW 11 118026749 missense probably damaging 1.00
R1716:Dnah17 UTSW 11 118032598 missense probably benign 0.00
R1727:Dnah17 UTSW 11 118070489 missense probably damaging 0.98
R1727:Dnah17 UTSW 11 118096536 nonsense probably null
R1728:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1852:Dnah17 UTSW 11 118121916 missense probably damaging 0.97
R1869:Dnah17 UTSW 11 118047189 nonsense probably null
R1886:Dnah17 UTSW 11 118108161 missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 118066968 missense probably benign 0.00
R1954:Dnah17 UTSW 11 118024731 missense probably damaging 1.00
R1969:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1975:Dnah17 UTSW 11 118096536 nonsense probably null
R1977:Dnah17 UTSW 11 118112591 missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 118067531 missense probably benign 0.00
R2115:Dnah17 UTSW 11 118119802 missense probably benign 0.00
R2132:Dnah17 UTSW 11 118033747 missense probably damaging 0.98
R2200:Dnah17 UTSW 11 118102409 splice site probably benign
R2277:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118126384 critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118125974 missense probably benign 0.10
R2497:Dnah17 UTSW 11 118087024 synonymous probably null
R2923:Dnah17 UTSW 11 118093547 missense probably damaging 1.00
R3121:Dnah17 UTSW 11 118041086 missense probably damaging 1.00
R3236:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3237:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3498:Dnah17 UTSW 11 118080849 splice site probably benign
R3499:Dnah17 UTSW 11 118080849 splice site probably benign
R3746:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3749:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3762:Dnah17 UTSW 11 118104526 missense probably benign 0.00
R3826:Dnah17 UTSW 11 118041158 splice site probably benign
R3828:Dnah17 UTSW 11 118041158 splice site probably benign
R3829:Dnah17 UTSW 11 118041158 splice site probably benign
R3877:Dnah17 UTSW 11 118024707 missense probably damaging 1.00
R3899:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 118080849 splice site probably benign
R3913:Dnah17 UTSW 11 118080849 splice site probably benign
R3930:Dnah17 UTSW 11 118080849 splice site probably benign
R3931:Dnah17 UTSW 11 118080849 splice site probably benign
R3969:Dnah17 UTSW 11 118041158 splice site probably benign
R3970:Dnah17 UTSW 11 118041158 splice site probably benign
R4056:Dnah17 UTSW 11 118070538 missense probably benign 0.05
R4113:Dnah17 UTSW 11 118112594 missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118118772 missense probably damaging 1.00
R4324:Dnah17 UTSW 11 118094213 missense probably benign 0.01
R4412:Dnah17 UTSW 11 118073683 missense probably damaging 1.00
R4413:Dnah17 UTSW 11 118025168 missense probably benign 0.00
R4422:Dnah17 UTSW 11 118081973 missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 118052943 missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 118074293 missense probably benign 0.02
R4677:Dnah17 UTSW 11 118119814 missense probably damaging 1.00
R4716:Dnah17 UTSW 11 118073648 missense probably benign 0.02
R4832:Dnah17 UTSW 11 118026780 missense probably damaging 1.00
R4868:Dnah17 UTSW 11 118108212 missense probably benign 0.03
R4897:Dnah17 UTSW 11 118078593 missense probably damaging 1.00
R4928:Dnah17 UTSW 11 118027433 missense probably damaging 1.00
R4937:Dnah17 UTSW 11 118042154 missense probably damaging 1.00
R4957:Dnah17 UTSW 11 118074298 missense probably benign 0.44
R5008:Dnah17 UTSW 11 118110577 missense probably benign 0.01
R5016:Dnah17 UTSW 11 118080766 missense probably damaging 0.96
R5027:Dnah17 UTSW 11 118102539 missense probably benign 0.01
R5133:Dnah17 UTSW 11 118117113 missense probably benign 0.00
R5140:Dnah17 UTSW 11 118086945 missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118114179 missense probably damaging 0.99
R5151:Dnah17 UTSW 11 118027467 missense probably damaging 1.00
R5153:Dnah17 UTSW 11 118082974 nonsense probably null
R5192:Dnah17 UTSW 11 118034359 missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118112514 missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118117203 intron probably benign
R5396:Dnah17 UTSW 11 118127282 missense probably benign
R5418:Dnah17 UTSW 11 118094984 missense probably benign 0.04
R5534:Dnah17 UTSW 11 118052770 missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 118073660 missense probably benign 0.03
R5594:Dnah17 UTSW 11 118043229 splice site probably null
R5634:Dnah17 UTSW 11 118052926 splice site probably null
R5696:Dnah17 UTSW 11 118101056 missense probably benign 0.44
R5802:Dnah17 UTSW 11 118036446 missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 118034367 missense probably damaging 1.00
R5873:Dnah17 UTSW 11 118056897 missense probably benign 0.01
R5898:Dnah17 UTSW 11 118114213 missense probably benign 0.00
R5934:Dnah17 UTSW 11 118041102 missense probably benign
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6113:Dnah17 UTSW 11 118126275 missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118119571 missense probably benign 0.00
R6137:Dnah17 UTSW 11 118025654 missense probably damaging 1.00
R6173:Dnah17 UTSW 11 118039946 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126323 nonsense probably null
R6258:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126323 nonsense probably null
R6260:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6278:Dnah17 UTSW 11 118126290 missense probably damaging 0.99
R6298:Dnah17 UTSW 11 118108161 missense probably benign 0.00
R6300:Dnah17 UTSW 11 118034310 missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118129155 missense probably benign 0.09
R6363:Dnah17 UTSW 11 118110505 missense probably benign
R6381:Dnah17 UTSW 11 118129185 missense probably benign 0.08
R6418:Dnah17 UTSW 11 118129197 missense probably damaging 0.99
R6660:Dnah17 UTSW 11 118100188 missense probably benign
R6803:Dnah17 UTSW 11 118125372 missense probably benign 0.00
R6820:Dnah17 UTSW 11 118069000 missense probably damaging 0.99
R6885:Dnah17 UTSW 11 118090772 missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 118041484 missense probably damaging 0.98
R6932:Dnah17 UTSW 11 118060079 missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 118066432 missense probably damaging 1.00
R7000:Dnah17 UTSW 11 118025702 critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118118871 missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 118046118 missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118125386 missense probably benign
R7131:Dnah17 UTSW 11 118079658 missense probably benign 0.14
R7143:Dnah17 UTSW 11 118086130 missense probably damaging 1.00
R7146:Dnah17 UTSW 11 118082110 missense probably damaging 0.98
R7147:Dnah17 UTSW 11 118094929 missense probably benign 0.31
R7172:Dnah17 UTSW 11 118041131 nonsense probably null
R7183:Dnah17 UTSW 11 118129188 missense probably benign
R7297:Dnah17 UTSW 11 118055730 critical splice donor site probably null
R7297:Dnah17 UTSW 11 118103356 missense probably damaging 0.98
R7367:Dnah17 UTSW 11 118115196 missense probably benign
R7398:Dnah17 UTSW 11 118080724 missense probably damaging 0.96
R7426:Dnah17 UTSW 11 118090717 missense probably null 0.79
R7524:Dnah17 UTSW 11 118121481 missense probably benign 0.03
R7529:Dnah17 UTSW 11 118049866 critical splice donor site probably null
R7615:Dnah17 UTSW 11 118110547 nonsense probably null
R7681:Dnah17 UTSW 11 118025186 missense probably damaging 1.00
R7702:Dnah17 UTSW 11 118025640 missense probably benign 0.00
R7702:Dnah17 UTSW 11 118121478 missense possibly damaging 0.64
R7713:Dnah17 UTSW 11 118025171 missense probably benign 0.02
R7809:Dnah17 UTSW 11 118104636 missense probably benign 0.09
X0058:Dnah17 UTSW 11 118082925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAATCAGGCCTGTGGGG -3'
(R):5'- AGGATGCTCTTCCAGGTCTG -3'

Sequencing Primer
(F):5'- GGGAGGGGGTCGTCTAC -3'
(R):5'- CTGTCTCTCATGAAGGCAAATGAC -3'
Posted On2014-08-25