Incidental Mutation 'R2029:Pkn1'
ID220969
Institutional Source Beutler Lab
Gene Symbol Pkn1
Ensembl Gene ENSMUSG00000057672
Gene Nameprotein kinase N1
SynonymsPRK1, F730027O18Rik, PAK1, Prkcl1, Pkn, Stk3
MMRRC Submission 040036-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2029 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83666536-83699179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83677963 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 496 (Q496L)
Ref Sequence ENSEMBL: ENSMUSP00000116235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005616] [ENSMUST00000132945] [ENSMUST00000144258]
Predicted Effect probably benign
Transcript: ENSMUST00000005616
AA Change: Q491L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000005616
Gene: ENSMUSG00000057672
AA Change: Q491L

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Hr1 37 101 6.74e-20 SMART
Hr1 126 194 1.13e-21 SMART
Hr1 216 284 7.79e-25 SMART
C2 328 464 2.45e-1 SMART
low complexity region 569 601 N/A INTRINSIC
S_TKc 619 878 2.83e-96 SMART
S_TK_X 879 943 5.29e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128523
Predicted Effect probably benign
Transcript: ENSMUST00000132945
AA Change: Q503L

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115054
Gene: ENSMUSG00000057672
AA Change: Q503L

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Hr1 49 113 6.74e-20 SMART
Hr1 138 206 1.13e-21 SMART
Hr1 228 296 7.79e-25 SMART
C2 340 476 2.45e-1 SMART
low complexity region 581 613 N/A INTRINSIC
Pfam:Pkinase 631 756 2.2e-23 PFAM
Pfam:Pkinase_Tyr 631 757 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133195
Predicted Effect possibly damaging
Transcript: ENSMUST00000144258
AA Change: Q496L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116235
Gene: ENSMUSG00000057672
AA Change: Q496L

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Hr1 42 106 6.74e-20 SMART
Hr1 131 199 1.13e-21 SMART
Hr1 221 289 7.79e-25 SMART
C2 333 469 2.45e-1 SMART
low complexity region 574 606 N/A INTRINSIC
S_TKc 624 883 2.83e-96 SMART
S_TK_X 884 948 5.29e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146057
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneously formed GCs and developed an autoimmune-like disease with autoantibody production and glomerulonephritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,067,624 S68* probably null Het
9130409I23Rik T A 1: 181,054,931 I86K probably benign Het
Adam18 C G 8: 24,650,877 G286A probably damaging Het
Adcy1 G A 11: 7,139,142 A519T probably benign Het
AI314180 G A 4: 58,844,165 R534* probably null Het
Anxa2 T A 9: 69,464,480 S2T possibly damaging Het
Ap3m1 G A 14: 21,039,149 S261L possibly damaging Het
Asna1 A T 8: 85,019,774 Y148* probably null Het
Baz2b A T 2: 59,912,723 probably benign Het
Brdt T A 5: 107,359,224 S497T probably benign Het
Cdh11 A G 8: 102,679,772 F23S probably benign Het
Cdh16 A C 8: 104,617,802 L540R probably damaging Het
Ces5a A T 8: 93,534,577 L74Q probably damaging Het
Cfap69 A G 5: 5,604,306 S543P probably damaging Het
Cfap74 T C 4: 155,442,081 I763T possibly damaging Het
Cma1 T A 14: 55,943,734 R58S possibly damaging Het
Csmd3 C T 15: 47,838,579 D1599N probably damaging Het
Cyld A G 8: 88,745,312 K857R probably benign Het
Cyp3a16 T C 5: 145,451,857 D270G probably damaging Het
D1Pas1 T C 1: 186,968,089 S72P possibly damaging Het
Ddx3y T C Y: 1,266,389 E331G probably benign Het
Dis3l2 T C 1: 86,854,467 probably benign Het
Dopey1 G T 9: 86,521,365 W1539C probably damaging Het
Dopey2 A G 16: 93,769,435 K917E probably benign Het
Efcab3 T C 11: 105,100,025 I5462T probably damaging Het
Epo A G 5: 137,485,185 probably benign Het
Figla T A 6: 86,020,642 probably benign Het
Flvcr1 T C 1: 191,021,156 D273G probably benign Het
Fryl T A 5: 73,022,122 R304* probably null Het
Gcm1 T G 9: 78,065,044 D422E possibly damaging Het
Ggt6 A G 11: 72,437,541 D251G possibly damaging Het
Git2 A G 5: 114,766,450 probably null Het
Gm18856 A T 13: 13,964,791 probably benign Het
Gm20939 T A 17: 94,875,824 probably benign Het
Gm5039 A T 12: 88,321,421 S21T unknown Het
Gm7534 T C 4: 134,202,358 K212R possibly damaging Het
Gpr176 A G 2: 118,279,432 Y449H probably benign Het
H2-Eb1 A G 17: 34,314,392 E196G probably damaging Het
H2-M10.6 A G 17: 36,813,907 T239A possibly damaging Het
Haus5 T C 7: 30,659,400 N237S possibly damaging Het
Hectd3 T C 4: 117,000,685 M605T probably damaging Het
Hps3 T C 3: 20,030,527 I166V probably benign Het
Ighv5-21 A T 12: 114,322,814 probably benign Het
Kdm6b C T 11: 69,403,592 G1218D unknown Het
Klhl30 A G 1: 91,357,914 probably null Het
Kmt2a A T 9: 44,818,450 S3523R probably benign Het
Lnpep A T 17: 17,568,399 N481K probably damaging Het
Lrp1b T C 2: 41,341,849 H1203R probably benign Het
Lrrc8a C T 2: 30,256,649 R492W probably damaging Het
Magel2 T A 7: 62,380,594 V1082D unknown Het
Memo1 A C 17: 74,245,054 H82Q probably null Het
Myh13 A T 11: 67,361,289 T1408S probably benign Het
Myh2 A T 11: 67,194,625 N1792Y possibly damaging Het
Myo1e A T 9: 70,368,687 N728I possibly damaging Het
Myo1e T C 9: 70,378,715 probably benign Het
Myo5c T C 9: 75,289,055 probably benign Het
Olfr1205 T A 2: 88,831,405 M96K possibly damaging Het
Olfr323 T A 11: 58,625,493 L184F probably damaging Het
Olfr378 A G 11: 73,425,362 V207A probably benign Het
Olfr578 T A 7: 102,984,271 T298S probably damaging Het
Olfr594 T C 7: 103,219,760 F14S probably damaging Het
Olfr715b T C 7: 107,106,436 I142V probably benign Het
Parp2 C T 14: 50,810,086 A18V probably benign Het
Peli1 T A 11: 21,148,110 C282S probably damaging Het
Piezo2 T C 18: 63,118,935 M404V possibly damaging Het
Pla2r1 A T 2: 60,431,973 F1093L probably damaging Het
Ppp2r3a A G 9: 101,145,481 V323A probably damaging Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prg2 C T 2: 84,981,998 probably benign Het
Ptprb G A 10: 116,347,053 G1545S probably benign Het
Rbm19 A G 5: 120,120,242 D174G possibly damaging Het
Rhbdf2 T A 11: 116,601,148 T526S probably damaging Het
Rpusd4 A G 9: 35,268,014 N42S probably benign Het
Ryr3 T A 2: 112,647,016 Q4455L possibly damaging Het
Sema4a G T 3: 88,451,361 H30Q probably damaging Het
Skint1 G A 4: 112,021,456 probably null Het
Slc1a3 A G 15: 8,645,669 V284A probably benign Het
Slc30a9 A T 5: 67,339,975 K288* probably null Het
Slc36a1 G T 11: 55,228,338 A380S probably benign Het
Slc47a1 G A 11: 61,378,007 probably benign Het
Snx19 A T 9: 30,429,000 E478V probably benign Het
Spag6 T C 2: 18,734,105 probably benign Het
Stag1 A T 9: 100,786,687 T223S probably damaging Het
Terb1 A T 8: 104,498,100 probably benign Het
Terf1 A G 1: 15,805,946 D90G possibly damaging Het
Tex15 A G 8: 33,571,274 D518G probably damaging Het
Tmem174 T A 13: 98,637,038 M95L possibly damaging Het
Tnnt3 GTCCAGGCATCTC GTC 7: 142,512,627 probably benign Het
Usp28 A G 9: 48,985,503 D8G probably benign Het
Vmn2r105 T C 17: 20,224,578 T551A probably damaging Het
Vmn2r107 A G 17: 20,375,287 I701V probably benign Het
Vmn2r13 A C 5: 109,192,077 F11V probably benign Het
Vmn2r85 G C 10: 130,425,574 S298* probably null Het
Wdr6 C G 9: 108,575,355 W443S probably damaging Het
Wipi1 A G 11: 109,583,190 V210A probably damaging Het
Zfp317 A G 9: 19,645,236 T47A probably benign Het
Zfp61 T C 7: 24,292,289 T146A probably benign Het
Zfp964 A G 8: 69,663,917 E389G unknown Het
Zfyve16 T C 13: 92,504,477 D1253G probably damaging Het
Zswim7 G A 11: 62,267,473 probably benign Het
Other mutations in Pkn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Pkn1 APN 8 83681006 missense probably damaging 0.96
IGL02058:Pkn1 APN 8 83681225 nonsense probably null
IGL03142:Pkn1 APN 8 83671023 missense possibly damaging 0.85
xinjiang UTSW 8 83692927 nonsense probably null
R0115:Pkn1 UTSW 8 83671029 missense probably damaging 0.99
R0157:Pkn1 UTSW 8 83692820 missense probably damaging 1.00
R0304:Pkn1 UTSW 8 83683607 splice site probably benign
R0450:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R0469:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R1419:Pkn1 UTSW 8 83673522 missense probably damaging 0.99
R1539:Pkn1 UTSW 8 83670337 missense possibly damaging 0.49
R2025:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2026:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2027:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2886:Pkn1 UTSW 8 83681238 missense probably benign 0.28
R3017:Pkn1 UTSW 8 83670170 missense probably benign 0.13
R3402:Pkn1 UTSW 8 83670230 missense probably damaging 1.00
R4110:Pkn1 UTSW 8 83691199 missense probably benign 0.41
R4504:Pkn1 UTSW 8 83692927 nonsense probably null
R4739:Pkn1 UTSW 8 83671749 missense probably damaging 0.98
R4838:Pkn1 UTSW 8 83677966 missense probably damaging 1.00
R4857:Pkn1 UTSW 8 83684227 splice site probably null
R5239:Pkn1 UTSW 8 83684182 missense probably damaging 1.00
R5558:Pkn1 UTSW 8 83684722 missense probably damaging 1.00
R5613:Pkn1 UTSW 8 83677761 missense probably benign 0.00
R6169:Pkn1 UTSW 8 83681206 nonsense probably null
R6172:Pkn1 UTSW 8 83670755 missense possibly damaging 0.48
R6273:Pkn1 UTSW 8 83672270 missense probably damaging 0.96
R6318:Pkn1 UTSW 8 83683591 missense probably damaging 1.00
R6531:Pkn1 UTSW 8 83670293 missense probably benign 0.09
R6969:Pkn1 UTSW 8 83683426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCACTAGGGATGAGTCTAC -3'
(R):5'- ACCCTCCTGTACGTAGTCAC -3'

Sequencing Primer
(F):5'- ATGAGTCTACGGAGCAGCC -3'
(R):5'- TGTACGTAGTCACTGCCAACAG -3'
Posted On2014-08-25