Mutagenetix > Incidental Mutation

Incidental Mutation 'R0138:Gcfc2'

22100

Institutional Source

Beutler Lab

Gene Symbol

Gcfc2

Ensembl Gene

ENSMUSG00000035125

Gene Name

GC-rich sequence DNA binding factor 2

Synonyms

AW146020

MMRRC Submission

038423-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.466) question?

Stock #

R0138 (G1)

Quality Score

206

Status

Validated (trace)

Chromosome

Chromosomal Location

81923669-81959915 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 81949954 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 608 (D608N)

Ref Sequence

ENSEMBL: ENSMUSP00000035644 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043195] [ENSMUST00000152996]

AlphaFold

Q8BKT3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043195
AA Change: D608N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: D608N

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC
coiled coil region	255	308	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
Pfam:GCFC	456	672	3e-34	PFAM
low complexity region	753	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129678

Predicted Effect

probably benign
Transcript: ENSMUST00000152996

SMART Domains

Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000203959
AA Change: D92N

Meta Mutation Damage Score

0.8334

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.4%
20x: 92.8%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,105,449	N693K	probably damaging	Het
Adgrl3	T	A	5: 81,693,607	V845D	probably damaging	Het
Anxa8	T	A	14: 34,097,939	F269Y	probably benign	Het
Anxa8	T	A	14: 34,097,940	F295L	possibly damaging	Het
Aox4	C	G	1: 58,228,866	L202V	probably damaging	Het
Ap3s2	A	G	7: 79,909,869	V104A	probably benign	Het
Aqp3	G	A	4: 41,094,843		probably benign	Het
Arhgef26	C	T	3: 62,448,259	H751Y	probably benign	Het
Asic4	A	T	1: 75,469,687	Q291L	possibly damaging	Het
Bap1	T	C	14: 31,256,724	Y31H	probably damaging	Het
Brf1	A	T	12: 112,961,139	V655D	probably damaging	Het
Cebpz	A	G	17: 78,931,391	S663P	probably benign	Het
Ces2h	A	G	8: 105,018,061	D357G	probably benign	Het
Cfap36	T	C	11: 29,244,073	T90A	probably benign	Het
Ciita	A	T	16: 10,512,270	D803V	probably damaging	Het
Clnk	C	A	5: 38,774,608		probably benign	Het
Cyp46a1	A	G	12: 108,351,211	N158S	probably damaging	Het
Cyp4f13	A	G	17: 32,941,106	I98T	possibly damaging	Het
Def8	G	A	8: 123,456,495	A278T	probably damaging	Het
Dll3	T	A	7: 28,301,321	D103V	possibly damaging	Het
Dnaic1	T	A	4: 41,629,814	M446K	possibly damaging	Het
Dppa4	A	T	16: 48,291,062	T85S	probably benign	Het
Eif4g1	A	T	16: 20,675,345	H57L	probably damaging	Het
Fmnl3	G	C	15: 99,322,738		probably benign	Het
Fn1	T	A	1: 71,624,110	Q1073L	possibly damaging	Het
Foxp4	T	C	17: 47,869,179	D599G	unknown	Het
Frrs1	T	C	3: 116,881,807	V128A	possibly damaging	Het
Gm1043	T	C	5: 37,192,973		probably benign	Het
Gm5148	T	C	3: 37,714,777	E98G	probably benign	Het
Gpr141	T	C	13: 19,752,258	I116V	probably benign	Het
Hic1	T	C	11: 75,167,343	N240S	probably damaging	Het
Hpx	G	A	7: 105,592,238	T322I	probably damaging	Het
Hs3st4	A	T	7: 124,397,193	M361L	probably benign	Het
Ifrd1	A	G	12: 40,207,130		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Klk1b21	T	A	7: 44,105,895	C173S	probably damaging	Het
Krt25	A	T	11: 99,322,698	V65E	probably benign	Het
Lrrc15	A	T	16: 30,273,449	D357E	possibly damaging	Het
Lrrd1	T	A	5: 3,851,345	V550E	probably benign	Het
Macf1	A	G	4: 123,440,747	Y1490H	probably damaging	Het
Macrod1	A	G	19: 7,196,916		probably benign	Het
Mcm5	T	A	8: 75,120,880	V435D	probably damaging	Het
Mctp1	C	T	13: 76,827,712	R478C	probably damaging	Het
Med10	T	C	13: 69,811,698		probably benign	Het
Mrpl4	T	C	9: 21,008,592	Y280H	probably benign	Het
Msrb3	T	C	10: 120,851,987	E61G	probably damaging	Het
Myo1c	T	C	11: 75,661,001	Y337H	possibly damaging	Het
Myo7b	T	A	18: 32,010,151	T165S	probably damaging	Het
Myrfl	T	A	10: 116,849,233	R81W	probably damaging	Het
Neil1	T	C	9: 57,143,746		probably benign	Het
Neto2	A	G	8: 85,641,044	I357T	possibly damaging	Het
Nfat5	C	T	8: 107,339,075	R156W	probably damaging	Het
Nkx6-3	T	C	8: 23,153,591	S3P	probably benign	Het
Olfr652	A	T	7: 104,565,003	I261L	probably benign	Het
Plce1	T	C	19: 38,524,419	I54T	possibly damaging	Het
Prex2	A	T	1: 11,285,043		probably benign	Het
Psapl1	T	A	5: 36,204,631	V189E	probably damaging	Het
Ptdss2	T	G	7: 141,155,319		probably benign	Het
Rnf213	T	C	11: 119,416,496	C661R	probably benign	Het
Rpap1	T	C	2: 119,764,899		probably null	Het
Rrp1b	A	G	17: 32,060,452	T696A	probably benign	Het
Sacm1l	T	A	9: 123,548,917	H87Q	probably benign	Het
Serpinb11	T	A	1: 107,377,530	M212K	probably damaging	Het
Tbc1d22a	C	A	15: 86,299,684	T248K	probably damaging	Het
Tcerg1	C	T	18: 42,568,614		probably benign	Het
Tpst1	T	A	5: 130,101,786	H32Q	probably damaging	Het
Tsc2	A	T	17: 24,599,626	V1412E	possibly damaging	Het
Usp19	C	A	9: 108,501,315	P1326Q	possibly damaging	Het
Vmn1r235	T	A	17: 21,262,334	M307K	probably damaging	Het
Vmn2r58	T	A	7: 41,837,624	T616S	probably damaging	Het
Vps13a	G	A	19: 16,660,499	T2406I	possibly damaging	Het
Zbtb26	T	A	2: 37,436,041	M328L	probably benign	Het
Zp2	A	G	7: 120,137,200	F340S	probably damaging	Het

Other mutations in Gcfc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Gcfc2	APN	6	81936015	missense	probably damaging	0.99
IGL00473:Gcfc2	APN	6	81944374	missense	probably damaging	1.00
IGL00497:Gcfc2	APN	6	81957970	missense	probably benign	0.08
IGL02135:Gcfc2	APN	6	81941400	missense	probably damaging	1.00
R0208:Gcfc2	UTSW	6	81943463	missense	probably null	0.91
R0467:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R1105:Gcfc2	UTSW	6	81939453	missense	probably damaging	1.00
R1521:Gcfc2	UTSW	6	81923812	missense	probably benign	0.14
R1602:Gcfc2	UTSW	6	81944420	missense	probably damaging	1.00
R1846:Gcfc2	UTSW	6	81956892	missense	probably damaging	0.99
R2091:Gcfc2	UTSW	6	81943479	missense	probably damaging	1.00
R2110:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2111:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2112:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2892:Gcfc2	UTSW	6	81956913	missense	possibly damaging	0.87
R3792:Gcfc2	UTSW	6	81930767	missense	probably benign	0.00
R4284:Gcfc2	UTSW	6	81941391	missense	probably damaging	1.00
R4304:Gcfc2	UTSW	6	81943007	missense	probably damaging	1.00
R4691:Gcfc2	UTSW	6	81941427	nonsense	probably null
R5046:Gcfc2	UTSW	6	81948335	missense	probably benign	0.12
R5233:Gcfc2	UTSW	6	81953290	missense	probably damaging	1.00
R5307:Gcfc2	UTSW	6	81944386	missense	probably damaging	0.97
R5308:Gcfc2	UTSW	6	81943543	critical splice donor site	probably null
R5929:Gcfc2	UTSW	6	81946599	missense	probably damaging	1.00
R6339:Gcfc2	UTSW	6	81946496	missense	probably damaging	1.00
R6485:Gcfc2	UTSW	6	81939547	missense	probably damaging	1.00
R6931:Gcfc2	UTSW	6	81942985	missense	probably benign	0.36
R6948:Gcfc2	UTSW	6	81933753	missense	probably benign	0.01
R7392:Gcfc2	UTSW	6	81943012	critical splice donor site	probably null
R7423:Gcfc2	UTSW	6	81946560	missense	probably damaging	1.00
R7509:Gcfc2	UTSW	6	81953275	missense	probably damaging	1.00
R7713:Gcfc2	UTSW	6	81941390	missense	probably damaging	1.00
R8089:Gcfc2	UTSW	6	81925790	missense	probably damaging	1.00
R8249:Gcfc2	UTSW	6	81956951	missense	probably benign	0.02
R8366:Gcfc2	UTSW	6	81923801	missense	probably benign	0.05
R8553:Gcfc2	UTSW	6	81935963	missense	probably benign	0.01
R8560:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R8779:Gcfc2	UTSW	6	81948317	missense	probably benign	0.00
R8915:Gcfc2	UTSW	6	81941366	missense	probably benign	0.36
R8924:Gcfc2	UTSW	6	81932898	missense	probably damaging	1.00
R9687:Gcfc2	UTSW	6	81941342	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACGAGTTGTATTCCAGCAGTTCC -3'
(R):5'- CCGCACTCCTATTCTGAACCATGAG -3'

Sequencing Primer
(F):5'- TGAGTGATCTAGTGACAACCAC -3'
(R):5'- TCAGGAAGCTCAAAGTCCTGTC -3'

Posted On

2013-04-12