Incidental Mutation 'R2029:Ptprb'
ID221009
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 040036-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2029 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116347053 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 1545 (G1545S)
Ref Sequence ENSEMBL: ENSMUSP00000089805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: G1258S

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: G1258S

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: G1545S

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,067,624 S68* probably null Het
9130409I23Rik T A 1: 181,054,931 I86K probably benign Het
Adam18 C G 8: 24,650,877 G286A probably damaging Het
Adcy1 G A 11: 7,139,142 A519T probably benign Het
AI314180 G A 4: 58,844,165 R534* probably null Het
Anxa2 T A 9: 69,464,480 S2T possibly damaging Het
Ap3m1 G A 14: 21,039,149 S261L possibly damaging Het
Asna1 A T 8: 85,019,774 Y148* probably null Het
Baz2b A T 2: 59,912,723 probably benign Het
Brdt T A 5: 107,359,224 S497T probably benign Het
Cdh11 A G 8: 102,679,772 F23S probably benign Het
Cdh16 A C 8: 104,617,802 L540R probably damaging Het
Ces5a A T 8: 93,534,577 L74Q probably damaging Het
Cfap69 A G 5: 5,604,306 S543P probably damaging Het
Cfap74 T C 4: 155,442,081 I763T possibly damaging Het
Cma1 T A 14: 55,943,734 R71S possibly damaging Het
Csmd3 C T 15: 47,838,579 D1599N probably damaging Het
Cyld A G 8: 88,745,312 K857R probably benign Het
Cyp3a16 T C 5: 145,451,857 D270G probably damaging Het
D1Pas1 T C 1: 186,968,089 S72P possibly damaging Het
Ddx3y T C Y: 1,266,389 E331G probably benign Het
Dis3l2 T C 1: 86,854,467 probably benign Het
Dopey1 G T 9: 86,521,365 W1539C probably damaging Het
Dopey2 A G 16: 93,769,435 K917E probably benign Het
Efcab3 T C 11: 105,100,025 I5462T probably damaging Het
Epo A G 5: 137,485,185 probably benign Het
Figla T A 6: 86,020,642 probably benign Het
Flvcr1 T C 1: 191,021,156 D273G probably benign Het
Fryl T A 5: 73,022,122 R2981* probably null Het
Gcm1 T G 9: 78,065,044 D422E possibly damaging Het
Ggt6 A G 11: 72,437,541 D251G possibly damaging Het
Git2 A G 5: 114,766,450 probably null Het
Gm18856 A T 13: 13,964,791 I318N probably benign Het
Gm20939 T A 17: 94,875,824 probably benign Het
Gm5039 A T 12: 88,321,421 S21T unknown Het
Gm7534 T C 4: 134,202,358 K212R possibly damaging Het
Gpr176 A G 2: 118,279,432 Y449H probably benign Het
H2-Eb1 A G 17: 34,314,392 E196G probably damaging Het
H2-M10.6 A G 17: 36,813,907 T239A possibly damaging Het
Haus5 T C 7: 30,659,400 N237S possibly damaging Het
Hectd3 T C 4: 117,000,685 M605T probably damaging Het
Hps3 T C 3: 20,030,527 I166V probably benign Het
Ighv5-21 A T 12: 114,322,814 probably benign Het
Kdm6b C T 11: 69,403,592 G1218D unknown Het
Klhl30 A G 1: 91,357,914 probably null Het
Kmt2a A T 9: 44,818,450 S3523R probably benign Het
Lnpep A T 17: 17,568,399 N481K probably damaging Het
Lrp1b T C 2: 41,341,849 H1203R probably benign Het
Lrrc8a C T 2: 30,256,649 R492W probably damaging Het
Magel2 T A 7: 62,380,594 V1082D unknown Het
Memo1 A C 17: 74,245,054 H82Q probably null Het
Myh13 A T 11: 67,361,289 T1408S probably benign Het
Myh2 A T 11: 67,194,625 N1792Y possibly damaging Het
Myo1e A T 9: 70,368,687 N728I possibly damaging Het
Myo1e T C 9: 70,378,715 probably benign Het
Myo5c T C 9: 75,289,055 probably benign Het
Olfr1205 T A 2: 88,831,405 M96K possibly damaging Het
Olfr323 T A 11: 58,625,493 L184F probably damaging Het
Olfr378 A G 11: 73,425,362 V207A probably benign Het
Olfr578 T A 7: 102,984,271 T298S probably damaging Het
Olfr594 T C 7: 103,219,760 F14S probably damaging Het
Olfr715b T C 7: 107,106,436 I142V probably benign Het
Parp2 C T 14: 50,810,086 A18V probably benign Het
Peli1 T A 11: 21,148,110 C282S probably damaging Het
Piezo2 T C 18: 63,118,935 M404V possibly damaging Het
Pkn1 T A 8: 83,677,963 Q496L possibly damaging Het
Pla2r1 A T 2: 60,431,973 F1093L probably damaging Het
Ppp2r3a A G 9: 101,145,481 V323A probably damaging Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prg2 C T 2: 84,981,998 probably benign Het
Rbm19 A G 5: 120,120,242 D174G possibly damaging Het
Rhbdf2 T A 11: 116,601,148 T526S probably damaging Het
Rpusd4 A G 9: 35,268,014 N42S probably benign Het
Ryr3 T A 2: 112,647,016 Q4455L possibly damaging Het
Sema4a G T 3: 88,451,361 H30Q probably damaging Het
Skint1 G A 4: 112,021,456 R195K probably null Het
Slc1a3 A G 15: 8,645,669 V284A probably benign Het
Slc30a9 A T 5: 67,339,975 K288* probably null Het
Slc36a1 G T 11: 55,228,338 A380S probably benign Het
Slc47a1 G A 11: 61,378,007 A14V probably benign Het
Snx19 A T 9: 30,429,000 E478V probably benign Het
Spag6 T C 2: 18,734,105 probably benign Het
Stag1 A T 9: 100,786,687 T223S probably damaging Het
Terb1 A T 8: 104,498,100 probably benign Het
Terf1 A G 1: 15,805,946 D90G possibly damaging Het
Tex15 A G 8: 33,571,274 D518G probably damaging Het
Tmem174 T A 13: 98,637,038 M95L possibly damaging Het
Tnnt3 GTCCAGGCATCTC GTC 7: 142,512,627 probably benign Het
Usp28 A G 9: 48,985,503 D8G probably benign Het
Vmn2r105 T C 17: 20,224,578 T551A probably damaging Het
Vmn2r107 A G 17: 20,375,287 I701V probably benign Het
Vmn2r13 A C 5: 109,192,077 F11V probably benign Het
Vmn2r85 G C 10: 130,425,574 S298* probably null Het
Wdr6 C G 9: 108,575,355 W443S probably damaging Het
Wipi1 A G 11: 109,583,190 V210A probably damaging Het
Zfp317 A G 9: 19,645,236 T47A probably benign Het
Zfp61 T C 7: 24,292,289 T146A probably benign Het
Zfp964 A G 8: 69,663,917 E389G unknown Het
Zfyve16 T C 13: 92,504,477 D1253G probably damaging Het
Zswim7 G A 11: 62,267,473 T147I probably benign Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 unclassified probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 unclassified probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 unclassified probably benign 0.05
IGL02876:Ptprb APN 10 116348211 unclassified probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCGGGGACTTTGACTTCTATGAG -3'
(R):5'- CATGTGGACATGTGCATGCAC -3'

Sequencing Primer
(F):5'- GAGCTGATTCTTTACAATCCCAACGG -3'
(R):5'- GTGTGTGACACAGAGAGAGAC -3'
Posted On2014-08-25