Incidental Mutation 'R0138:Dll3'
ID22101
Institutional Source Beutler Lab
Gene Symbol Dll3
Ensembl Gene ENSMUSG00000003436
Gene Namedelta like canonical Notch ligand 3
Synonyms
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R0138 (G1)
Quality Score172
Status Validated (trace)
Chromosome7
Chromosomal Location28293553-28302238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28301321 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 103 (D103V)
Ref Sequence ENSEMBL: ENSMUSP00000103951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081946] [ENSMUST00000108315]
Predicted Effect probably benign
Transcript: ENSMUST00000081946
SMART Domains Protein: ENSMUSP00000080614
Gene: ENSMUSG00000003438

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
CPDc 146 274 1.33e-41 SMART
low complexity region 313 330 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108315
AA Change: D103V

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103951
Gene: ENSMUSG00000003436
AA Change: D103V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 60 118 3e-18 BLAST
low complexity region 140 154 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
EGF 211 247 1.53e1 SMART
EGF 275 308 3.08e-6 SMART
EGF 313 349 8.25e-7 SMART
EGF 354 387 2.83e-5 SMART
EGF 392 425 1.04e-3 SMART
EGF 430 463 7.07e-6 SMART
transmembrane domain 489 511 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151990
Meta Mutation Damage Score 0.3351 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the delta protein ligand family. This family functions as Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. Mutations in this gene cause autosomal recessive spondylocostal dysostosis 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, a shortened body and tail, delayed and abnormal somite formation, a kinked neural tube, disorganized PNS elements, and severe axial skeletal dysplasia, including disorganized vertebrae and ribs defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Dll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0024:Dll3 UTSW 7 28300161 splice site probably benign
R0322:Dll3 UTSW 7 28296368 missense possibly damaging 0.88
R0479:Dll3 UTSW 7 28301549 missense probably damaging 1.00
R1711:Dll3 UTSW 7 28294497 missense probably damaging 0.98
R1742:Dll3 UTSW 7 28294423 missense probably benign 0.37
R1854:Dll3 UTSW 7 28296410 missense probably damaging 1.00
R1920:Dll3 UTSW 7 28298923 missense probably benign
R3037:Dll3 UTSW 7 28299117 missense probably damaging 0.99
R3158:Dll3 UTSW 7 28294095 missense possibly damaging 0.50
R4306:Dll3 UTSW 7 28301657 unclassified probably null
R4424:Dll3 UTSW 7 28296291 missense probably damaging 1.00
R4873:Dll3 UTSW 7 28296435 missense probably damaging 1.00
R4875:Dll3 UTSW 7 28296435 missense probably damaging 1.00
R5604:Dll3 UTSW 7 28294632 missense probably benign
R5770:Dll3 UTSW 7 28299009 missense possibly damaging 0.84
R5988:Dll3 UTSW 7 28294112 missense probably damaging 0.98
R7204:Dll3 UTSW 7 28298905 missense possibly damaging 0.95
R7347:Dll3 UTSW 7 28299111 missense probably damaging 0.99
R7373:Dll3 UTSW 7 28294632 missense probably benign
R7694:Dll3 UTSW 7 28301745 start codon destroyed probably null 0.83
R7829:Dll3 UTSW 7 28294650 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACATCCCTGAAGAGAATAGCGGAG -3'
(R):5'- GGTCCCTTAACCTTGTGGCCCT -3'

Sequencing Primer
(F):5'- ATAGCGGAGGGGGTCTGG -3'
(R):5'- GGTGTCTTCGAGCTACAAATTC -3'
Posted On2013-04-12