Incidental Mutation 'R1972:Stk4'
ID221033
Institutional Source Beutler Lab
Gene Symbol Stk4
Ensembl Gene ENSMUSG00000018209
Gene Nameserine/threonine kinase 4
SynonymsYsk3, sterile 20-like kinase 1, Kas-2, Mst1
MMRRC Submission 039985-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1972 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164070322-164155524 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164100528 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 360 (T360M)
Ref Sequence ENSEMBL: ENSMUSP00000018353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018353]
Predicted Effect probably benign
Transcript: ENSMUST00000018353
AA Change: T360M

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209
AA Change: T360M

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137866
AA Change: T75M
SMART Domains Protein: ENSMUSP00000116745
Gene: ENSMUSG00000018209
AA Change: T75M

DomainStartEndE-ValueType
Blast:S_TKc 2 26 8e-6 BLAST
PDB:3COM|B 2 26 4e-7 PDB
low complexity region 27 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153319
Meta Mutation Damage Score 0.1297 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,990,418 probably benign Het
Bbs2 A G 8: 94,081,177 probably benign Het
Bcl9 A C 3: 97,207,202 D1035E probably damaging Het
Bmpr2 A G 1: 59,813,603 E31G possibly damaging Het
Borcs5 A G 6: 134,710,174 D164G probably damaging Het
Cap2 A G 13: 46,637,899 R181G probably damaging Het
Ccdc113 A T 8: 95,538,246 H128L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chrm4 C T 2: 91,927,493 A82V probably benign Het
Cyp2d22 A T 15: 82,375,827 M52K probably benign Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dgka C T 10: 128,720,466 G717D probably damaging Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Eif2ak1 A G 5: 143,884,714 T283A probably benign Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Fcgbp A T 7: 28,094,192 Y1173F probably benign Het
Flt1 G A 5: 147,655,093 probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Gsdma2 T C 11: 98,650,918 V157A probably benign Het
Heatr4 T A 12: 83,955,020 I884F probably damaging Het
Il17ra A G 6: 120,482,216 E776G probably benign Het
Inpp5d T C 1: 87,676,314 S235P probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Isoc2a T A 7: 4,892,087 D171E probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kcnk12 T C 17: 87,797,132 D108G possibly damaging Het
Klra9 A T 6: 130,182,382 probably null Het
Lgmn A G 12: 102,395,821 probably benign Het
Morf4l1 A T 9: 90,095,214 probably benign Het
Mthfr T C 4: 148,051,927 I380T probably damaging Het
Mybpc1 T C 10: 88,551,542 I436V probably benign Het
Naip5 A G 13: 100,212,770 V1350A probably damaging Het
Neil2 A T 14: 63,186,077 C36S possibly damaging Het
Nlrx1 A G 9: 44,253,456 V897A probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nop2 A G 6: 125,134,639 T112A probably benign Het
Nrap T A 19: 56,357,353 T608S probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Olfr1218 A T 2: 89,054,547 M293K probably benign Het
Olfr1475 T C 19: 13,479,694 N168S probably benign Het
Olfr209 A T 16: 59,362,113 V35D probably damaging Het
Olfr417 T C 1: 174,369,570 F218L probably benign Het
Olfr671 T C 7: 104,975,899 I33V possibly damaging Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Pde1a T C 2: 79,865,721 E358G probably damaging Het
Pdlim1 A T 19: 40,223,137 S237R probably damaging Het
Pithd1 T C 4: 135,987,029 D36G probably damaging Het
Ppp2r3a A G 9: 101,211,777 F449S probably benign Het
Prr11 G A 11: 87,098,754 R264C possibly damaging Het
Rbm43 A T 2: 51,925,536 H224Q probably benign Het
Rfx5 C T 3: 94,957,292 L250F probably damaging Het
Rgs22 T A 15: 36,103,836 I160L probably benign Het
Rorb T A 19: 18,952,203 Q393H probably damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Scaf8 T G 17: 3,169,371 S276R unknown Het
Scube2 A T 7: 109,809,214 N675K probably benign Het
Sec22c A T 9: 121,688,254 M126K possibly damaging Het
Serpinb11 T C 1: 107,369,480 F29L probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc18a2 A G 19: 59,274,653 D294G possibly damaging Het
Slc9c1 A G 16: 45,593,472 T988A possibly damaging Het
Smndc1 A C 19: 53,383,555 probably null Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spatc1 A T 15: 76,284,875 probably null Het
Stab2 A T 10: 86,960,316 C356S probably damaging Het
Tbc1d30 A T 10: 121,306,230 probably null Het
Tenm3 T C 8: 48,228,591 E2668G probably damaging Het
Tigar A G 6: 127,087,926 V253A possibly damaging Het
Tmc2 T A 2: 130,214,664 probably benign Het
Ttc26 C A 6: 38,410,803 N396K probably benign Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Vmn2r82 A G 10: 79,378,846 D221G probably damaging Het
Xkr5 C T 8: 18,941,981 V131M probably damaging Het
Other mutations in Stk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Stk4 APN 2 164118079 missense probably benign 0.05
IGL01583:Stk4 APN 2 164074214 start codon destroyed probably null 0.21
IGL01933:Stk4 APN 2 164098585 unclassified probably benign
IGL02084:Stk4 APN 2 164086607 missense probably benign 0.05
IGL02423:Stk4 APN 2 164086499 missense probably benign 0.00
IGL02601:Stk4 APN 2 164086542 missense probably damaging 1.00
IGL02712:Stk4 APN 2 164096897 missense probably damaging 1.00
hallon UTSW 2 164099827 critical splice donor site probably null
iwo_jima UTSW 2 164088959 missense possibly damaging 0.94
ribeye UTSW 2 164079566 missense probably damaging 1.00
sergeant UTSW 2 164099712 missense probably benign
stryker UTSW 2 164083688 nonsense probably null
R0377:Stk4 UTSW 2 164096800 missense probably damaging 1.00
R0607:Stk4 UTSW 2 164098542 missense probably damaging 1.00
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1973:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1976:Stk4 UTSW 2 164100528 missense probably benign 0.04
R2025:Stk4 UTSW 2 164096831 missense probably damaging 1.00
R3155:Stk4 UTSW 2 164151743 missense probably benign 0.01
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3733:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3734:Stk4 UTSW 2 164088908 missense probably benign 0.05
R4288:Stk4 UTSW 2 164099712 missense probably benign
R4296:Stk4 UTSW 2 164117984 missense possibly damaging 0.69
R4360:Stk4 UTSW 2 164088959 missense possibly damaging 0.94
R4829:Stk4 UTSW 2 164099827 critical splice donor site probably null
R4954:Stk4 UTSW 2 164151681 missense possibly damaging 0.75
R4954:Stk4 UTSW 2 164151682 missense probably damaging 1.00
R5088:Stk4 UTSW 2 164083688 nonsense probably null
R5188:Stk4 UTSW 2 164088908 missense possibly damaging 0.85
R5283:Stk4 UTSW 2 164110279 nonsense probably null
R5554:Stk4 UTSW 2 164099725 missense probably benign
R5605:Stk4 UTSW 2 164079566 missense probably damaging 1.00
R5694:Stk4 UTSW 2 164100564 missense possibly damaging 0.87
R5711:Stk4 UTSW 2 164099754 missense probably benign 0.20
R7453:Stk4 UTSW 2 164086602 missense probably benign 0.01
R7698:Stk4 UTSW 2 164083743 missense probably damaging 1.00
R7726:Stk4 UTSW 2 164110226 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TGACTCAGGACGTTCAGTTAG -3'
(R):5'- AGCATTCAGACGAAGCTCCC -3'

Sequencing Primer
(F):5'- TCAGGACGTTCAGTTAGCTCCAG -3'
(R):5'- AGCCTACTGCCAGCATTC -3'
Posted On2014-08-25