Incidental Mutation 'R1972:Il17ra'
ID221061
Institutional Source Beutler Lab
Gene Symbol Il17ra
Ensembl Gene ENSMUSG00000002897
Gene Nameinterleukin 17 receptor A
SynonymsVDw217, Il17r
MMRRC Submission 039985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1972 (G1)
Quality Score186
Status Validated
Chromosome6
Chromosomal Location120463247-120487559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120482216 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 776 (E776G)
Ref Sequence ENSEMBL: ENSMUSP00000002976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002976]
Predicted Effect probably benign
Transcript: ENSMUST00000002976
AA Change: E776G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000002976
Gene: ENSMUSG00000002897
AA Change: E776G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 48 198 1.3e-70 PFAM
Pfam:IL17R_fnIII_D2 199 303 9.6e-53 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:SEFIR 380 539 1.5e-51 PFAM
low complexity region 747 765 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204239
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed neutrophil recruitment and enhanced susceptibility to intranasal infection by Klibsiella pneumoniae. Mice homozygous for a different knock-out allele exhibit delayed and milder IMQ-induced psoriasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,990,418 probably benign Het
Bbs2 A G 8: 94,081,177 probably benign Het
Bcl9 A C 3: 97,207,202 D1035E probably damaging Het
Bmpr2 A G 1: 59,813,603 E31G possibly damaging Het
Borcs5 A G 6: 134,710,174 D164G probably damaging Het
Cap2 A G 13: 46,637,899 R181G probably damaging Het
Ccdc113 A T 8: 95,538,246 H128L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chrm4 C T 2: 91,927,493 A82V probably benign Het
Cyp2d22 A T 15: 82,375,827 M52K probably benign Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dgka C T 10: 128,720,466 G717D probably damaging Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Eif2ak1 A G 5: 143,884,714 T283A probably benign Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Fcgbp A T 7: 28,094,192 Y1173F probably benign Het
Flt1 G A 5: 147,655,093 probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Gsdma2 T C 11: 98,650,918 V157A probably benign Het
Heatr4 T A 12: 83,955,020 I884F probably damaging Het
Inpp5d T C 1: 87,676,314 S235P probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Isoc2a T A 7: 4,892,087 D171E probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kcnk12 T C 17: 87,797,132 D108G possibly damaging Het
Klra9 A T 6: 130,182,382 probably null Het
Lgmn A G 12: 102,395,821 probably benign Het
Morf4l1 A T 9: 90,095,214 probably benign Het
Mthfr T C 4: 148,051,927 I380T probably damaging Het
Mybpc1 T C 10: 88,551,542 I436V probably benign Het
Naip5 A G 13: 100,212,770 V1350A probably damaging Het
Neil2 A T 14: 63,186,077 C36S possibly damaging Het
Nlrx1 A G 9: 44,253,456 V897A probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nop2 A G 6: 125,134,639 T112A probably benign Het
Nrap T A 19: 56,357,353 T608S probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Olfr1218 A T 2: 89,054,547 M293K probably benign Het
Olfr1475 T C 19: 13,479,694 N168S probably benign Het
Olfr209 A T 16: 59,362,113 V35D probably damaging Het
Olfr417 T C 1: 174,369,570 F218L probably benign Het
Olfr671 T C 7: 104,975,899 I33V possibly damaging Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Pde1a T C 2: 79,865,721 E358G probably damaging Het
Pdlim1 A T 19: 40,223,137 S237R probably damaging Het
Pithd1 T C 4: 135,987,029 D36G probably damaging Het
Ppp2r3a A G 9: 101,211,777 F449S probably benign Het
Prr11 G A 11: 87,098,754 R264C possibly damaging Het
Rbm43 A T 2: 51,925,536 H224Q probably benign Het
Rfx5 C T 3: 94,957,292 L250F probably damaging Het
Rgs22 T A 15: 36,103,836 I160L probably benign Het
Rorb T A 19: 18,952,203 Q393H probably damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Scaf8 T G 17: 3,169,371 S276R unknown Het
Scube2 A T 7: 109,809,214 N675K probably benign Het
Sec22c A T 9: 121,688,254 M126K possibly damaging Het
Serpinb11 T C 1: 107,369,480 F29L probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc18a2 A G 19: 59,274,653 D294G possibly damaging Het
Slc9c1 A G 16: 45,593,472 T988A possibly damaging Het
Smndc1 A C 19: 53,383,555 probably null Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spatc1 A T 15: 76,284,875 probably null Het
Stab2 A T 10: 86,960,316 C356S probably damaging Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tbc1d30 A T 10: 121,306,230 probably null Het
Tenm3 T C 8: 48,228,591 E2668G probably damaging Het
Tigar A G 6: 127,087,926 V253A possibly damaging Het
Tmc2 T A 2: 130,214,664 probably benign Het
Ttc26 C A 6: 38,410,803 N396K probably benign Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Vmn2r82 A G 10: 79,378,846 D221G probably damaging Het
Xkr5 C T 8: 18,941,981 V131M probably damaging Het
Other mutations in Il17ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Il17ra APN 6 120481465 missense probably damaging 1.00
IGL01413:Il17ra APN 6 120475581 missense probably benign 0.00
IGL01418:Il17ra APN 6 120475581 missense probably benign 0.00
IGL03215:Il17ra APN 6 120472114 missense probably damaging 1.00
IGL03047:Il17ra UTSW 6 120481226 missense probably damaging 1.00
PIT4305001:Il17ra UTSW 6 120481406 missense probably damaging 1.00
R0042:Il17ra UTSW 6 120472125 splice site probably benign
R0042:Il17ra UTSW 6 120472125 splice site probably benign
R0365:Il17ra UTSW 6 120478449 missense probably benign 0.03
R0391:Il17ra UTSW 6 120476979 splice site probably benign
R0470:Il17ra UTSW 6 120481806 missense probably benign 0.01
R0599:Il17ra UTSW 6 120481505 missense probably damaging 1.00
R1525:Il17ra UTSW 6 120473790 missense probably damaging 0.98
R1900:Il17ra UTSW 6 120477394 critical splice acceptor site probably null
R4192:Il17ra UTSW 6 120481511 missense probably damaging 1.00
R4923:Il17ra UTSW 6 120477445 missense possibly damaging 0.94
R5009:Il17ra UTSW 6 120482207 missense probably benign 0.00
R5133:Il17ra UTSW 6 120481553 missense possibly damaging 0.81
R5411:Il17ra UTSW 6 120481442 missense probably damaging 1.00
R5548:Il17ra UTSW 6 120478473 missense probably benign 0.23
R6137:Il17ra UTSW 6 120475582 missense probably benign 0.23
R6190:Il17ra UTSW 6 120475273 missense probably damaging 1.00
R7202:Il17ra UTSW 6 120475611 missense probably benign 0.01
R7300:Il17ra UTSW 6 120482102 missense probably benign 0.00
R8130:Il17ra UTSW 6 120478455 missense probably benign 0.01
R8152:Il17ra UTSW 6 120482102 missense probably benign 0.00
R8213:Il17ra UTSW 6 120473034 missense probably benign 0.39
R8525:Il17ra UTSW 6 120474337 nonsense probably null
R8560:Il17ra UTSW 6 120482265 missense possibly damaging 0.78
R8675:Il17ra UTSW 6 120481988 missense probably benign 0.05
R8754:Il17ra UTSW 6 120481456 missense probably benign 0.09
R8956:Il17ra UTSW 6 120481504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCTATGGCCACAGAGAG -3'
(R):5'- AAGAAAAGCTGCCTCTGGAGC -3'

Sequencing Primer
(F):5'- GGTCCAGAGGAACAGCATCC -3'
(R):5'- AGCTTCCTCAGGCTCCGTAG -3'
Posted On2014-08-25