Incidental Mutation 'R1972:Olfr671'
ID221081
Institutional Source Beutler Lab
Gene Symbol Olfr671
Ensembl Gene ENSMUSG00000094531
Gene Nameolfactory receptor 671
SynonymsGA_x6K02T2PBJ9-7604826-7603885, MOR32-12
MMRRC Submission 039985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1972 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104972896-104979126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104975899 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 33 (I33V)
Ref Sequence ENSEMBL: ENSMUSP00000150911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078710] [ENSMUST00000210963] [ENSMUST00000217091]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078710
AA Change: I29V

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077774
Gene: ENSMUSG00000094531
AA Change: I29V

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.4e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 3.7e-7 PFAM
Pfam:7tm_1 43 293 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210963
AA Change: I33V

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217091
AA Change: I33V

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.2703 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,990,418 probably benign Het
Bbs2 A G 8: 94,081,177 probably benign Het
Bcl9 A C 3: 97,207,202 D1035E probably damaging Het
Bmpr2 A G 1: 59,813,603 E31G possibly damaging Het
Borcs5 A G 6: 134,710,174 D164G probably damaging Het
Cap2 A G 13: 46,637,899 R181G probably damaging Het
Ccdc113 A T 8: 95,538,246 H128L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chrm4 C T 2: 91,927,493 A82V probably benign Het
Cyp2d22 A T 15: 82,375,827 M52K probably benign Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dgka C T 10: 128,720,466 G717D probably damaging Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Eif2ak1 A G 5: 143,884,714 T283A probably benign Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Fcgbp A T 7: 28,094,192 Y1173F probably benign Het
Flt1 G A 5: 147,655,093 probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Gsdma2 T C 11: 98,650,918 V157A probably benign Het
Heatr4 T A 12: 83,955,020 I884F probably damaging Het
Il17ra A G 6: 120,482,216 E776G probably benign Het
Inpp5d T C 1: 87,676,314 S235P probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Isoc2a T A 7: 4,892,087 D171E probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kcnk12 T C 17: 87,797,132 D108G possibly damaging Het
Klra9 A T 6: 130,182,382 probably null Het
Lgmn A G 12: 102,395,821 probably benign Het
Morf4l1 A T 9: 90,095,214 probably benign Het
Mthfr T C 4: 148,051,927 I380T probably damaging Het
Mybpc1 T C 10: 88,551,542 I436V probably benign Het
Naip5 A G 13: 100,212,770 V1350A probably damaging Het
Neil2 A T 14: 63,186,077 C36S possibly damaging Het
Nlrx1 A G 9: 44,253,456 V897A probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nop2 A G 6: 125,134,639 T112A probably benign Het
Nrap T A 19: 56,357,353 T608S probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Olfr1218 A T 2: 89,054,547 M293K probably benign Het
Olfr1475 T C 19: 13,479,694 N168S probably benign Het
Olfr209 A T 16: 59,362,113 V35D probably damaging Het
Olfr417 T C 1: 174,369,570 F218L probably benign Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Pde1a T C 2: 79,865,721 E358G probably damaging Het
Pdlim1 A T 19: 40,223,137 S237R probably damaging Het
Pithd1 T C 4: 135,987,029 D36G probably damaging Het
Ppp2r3a A G 9: 101,211,777 F449S probably benign Het
Prr11 G A 11: 87,098,754 R264C possibly damaging Het
Rbm43 A T 2: 51,925,536 H224Q probably benign Het
Rfx5 C T 3: 94,957,292 L250F probably damaging Het
Rgs22 T A 15: 36,103,836 I160L probably benign Het
Rorb T A 19: 18,952,203 Q393H probably damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Scaf8 T G 17: 3,169,371 S276R unknown Het
Scube2 A T 7: 109,809,214 N675K probably benign Het
Sec22c A T 9: 121,688,254 M126K possibly damaging Het
Serpinb11 T C 1: 107,369,480 F29L probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc18a2 A G 19: 59,274,653 D294G possibly damaging Het
Slc9c1 A G 16: 45,593,472 T988A possibly damaging Het
Smndc1 A C 19: 53,383,555 probably null Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spatc1 A T 15: 76,284,875 probably null Het
Stab2 A T 10: 86,960,316 C356S probably damaging Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tbc1d30 A T 10: 121,306,230 probably null Het
Tenm3 T C 8: 48,228,591 E2668G probably damaging Het
Tigar A G 6: 127,087,926 V253A possibly damaging Het
Tmc2 T A 2: 130,214,664 probably benign Het
Ttc26 C A 6: 38,410,803 N396K probably benign Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Vmn2r82 A G 10: 79,378,846 D221G probably damaging Het
Xkr5 C T 8: 18,941,981 V131M probably damaging Het
Other mutations in Olfr671
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Olfr671 APN 7 104975986 unclassified probably null
IGL02154:Olfr671 APN 7 104975981 start codon destroyed probably null 0.14
IGL02308:Olfr671 APN 7 104975458 missense possibly damaging 0.84
IGL02794:Olfr671 APN 7 104975389 missense probably benign
R0919:Olfr671 UTSW 7 104975312 nonsense probably null
R1819:Olfr671 UTSW 7 104975398 missense probably benign 0.01
R2025:Olfr671 UTSW 7 104975244 missense probably benign 0.01
R4910:Olfr671 UTSW 7 104975479 missense possibly damaging 0.88
R5442:Olfr671 UTSW 7 104975228 missense possibly damaging 0.80
R5554:Olfr671 UTSW 7 104975982 start codon destroyed probably null 0.99
R5932:Olfr671 UTSW 7 104975655 missense probably damaging 1.00
R6683:Olfr671 UTSW 7 104975968 missense probably benign
R6962:Olfr671 UTSW 7 104975373 missense probably benign 0.00
R7000:Olfr671 UTSW 7 104975131 missense probably damaging 1.00
R7059:Olfr671 UTSW 7 104976017 splice site probably null
R7276:Olfr671 UTSW 7 104975650 missense possibly damaging 0.62
R7425:Olfr671 UTSW 7 104975061 nonsense probably null
R7688:Olfr671 UTSW 7 104975125 missense possibly damaging 0.60
R8043:Olfr671 UTSW 7 104975873 nonsense probably null
R8074:Olfr671 UTSW 7 104975727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCAGAAGATGCCCAG -3'
(R):5'- GCTCGATACCTGATGCCATG -3'

Sequencing Primer
(F):5'- CCAGCATTTTGGGGATGGTG -3'
(R):5'- ACCTGATGCCATGTAAAATTTTGG -3'
Posted On2014-08-25