Incidental Mutation 'R2030:Olfr1245'
ID221094
Institutional Source Beutler Lab
Gene Symbol Olfr1245
Ensembl Gene ENSMUSG00000111456
Gene Nameolfactory receptor 1245
SynonymsGA_x6K02T2Q125-51020951-51020028, MOR231-12
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89573406-89578447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89575214 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 171 (V171I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
Predicted Effect probably benign
Transcript: ENSMUST00000099766
AA Change: V171I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: V171I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099773
AA Change: V171I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097361
Gene: ENSMUSG00000075083
AA Change: V171I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214870
AA Change: V171I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217402
AA Change: V171I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Olfr1245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Olfr1245 APN 2 89575423 missense possibly damaging 0.68
IGL01690:Olfr1245 APN 2 89575213 missense probably benign 0.09
IGL02334:Olfr1245 APN 2 89575324 missense possibly damaging 0.95
IGL02435:Olfr1245 APN 2 89575546 missense probably damaging 0.99
IGL02793:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL02875:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL03218:Olfr1245 APN 2 89575591 missense probably benign 0.09
IGL03392:Olfr1245 APN 2 89575249 missense probably damaging 0.96
H8786:Olfr1245 UTSW 2 89575279 missense probably damaging 1.00
I0000:Olfr1245 UTSW 2 89575153 missense probably damaging 1.00
R0044:Olfr1245 UTSW 2 89575630 missense possibly damaging 0.68
R0190:Olfr1245 UTSW 2 89574958 missense probably damaging 0.98
R1585:Olfr1245 UTSW 2 89575402 missense possibly damaging 0.89
R1902:Olfr1245 UTSW 2 89575603 missense possibly damaging 0.77
R2018:Olfr1245 UTSW 2 89575393 missense probably damaging 0.97
R2019:Olfr1245 UTSW 2 89575393 missense probably damaging 0.97
R2020:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2021:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2133:Olfr1245 UTSW 2 89575256 nonsense probably null
R3850:Olfr1245 UTSW 2 89575034 missense probably damaging 0.99
R4066:Olfr1245 UTSW 2 89575179 missense probably damaging 1.00
R4754:Olfr1245 UTSW 2 89575047 missense probably benign
R4923:Olfr1245 UTSW 2 89575679 missense probably damaging 0.98
R5303:Olfr1245 UTSW 2 89575001 missense possibly damaging 0.88
R5574:Olfr1245 UTSW 2 89574977 missense possibly damaging 0.94
R6083:Olfr1245 UTSW 2 89575672 missense probably benign 0.42
R6188:Olfr1245 UTSW 2 89575194 nonsense probably null
R6724:Olfr1245 UTSW 2 89574965 missense probably benign 0.26
R6964:Olfr1245 UTSW 2 89574989 missense probably benign
R7066:Olfr1245 UTSW 2 89575703 missense probably damaging 0.98
R7401:Olfr1245 UTSW 2 89575105 missense probably benign 0.27
R8232:Olfr1245 UTSW 2 89575594 missense noncoding transcript
R8558:Olfr1245 UTSW 2 89574985 missense probably damaging 1.00
R8708:Olfr1245 UTSW 2 89575279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAACTGGTCGGGCATAC -3'
(R):5'- GTGGCAATGGCTTATGATCGC -3'

Sequencing Primer
(F):5'- CTGGTCGGGCATACATAAAAATAC -3'
(R):5'- CGCTATGTGGCAATCTGTAAGCC -3'
Posted On2014-08-25