Incidental Mutation 'R2030:Zc3h6'
ID 221098
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission 040037-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.168) question?
Stock # R2030 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128848006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 278 (Y278H)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110320
AA Change: Y278H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: Y278H

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Meta Mutation Damage Score 0.4756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp C T 13: 41,981,735 (GRCm39) V13I probably damaging Het
Ak2 A G 4: 128,902,013 (GRCm39) K229E probably benign Het
Atp13a4 A T 16: 29,241,502 (GRCm39) V741D probably damaging Het
Bdp1 A T 13: 100,197,697 (GRCm39) M896K probably benign Het
Ccser1 C T 6: 61,288,547 (GRCm39) R237C probably benign Het
Cdk7 A G 13: 100,859,182 (GRCm39) probably benign Het
CK137956 A G 4: 127,845,180 (GRCm39) S188P probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dbndd2 A G 2: 164,330,563 (GRCm39) D72G probably damaging Het
Disp3 A T 4: 148,344,423 (GRCm39) I493N probably damaging Het
Dnaaf10 A T 11: 17,179,832 (GRCm39) T278S probably benign Het
Epx T C 11: 87,755,650 (GRCm39) D678G probably damaging Het
Fbxw5 G T 2: 25,394,810 (GRCm39) V235L probably damaging Het
Fmo4 T A 1: 162,621,741 (GRCm39) D490V probably damaging Het
Fuca2 A G 10: 13,382,518 (GRCm39) Y268C probably damaging Het
Gm4787 C T 12: 81,425,544 (GRCm39) V205I probably damaging Het
Gpat3 G A 5: 101,045,687 (GRCm39) R437K probably benign Het
Herc2 A G 7: 55,834,121 (GRCm39) S3109G probably damaging Het
Hr G A 14: 70,808,888 (GRCm39) R1117H probably damaging Het
Htra4 T A 8: 25,523,593 (GRCm39) D324V probably damaging Het
Kcnd3 A G 3: 105,366,853 (GRCm39) Y241C probably damaging Het
Kcp G A 6: 29,489,071 (GRCm39) L1072F probably damaging Het
Lrrc52 T C 1: 167,294,028 (GRCm39) N86D probably benign Het
Mindy4 A G 6: 55,188,247 (GRCm39) T26A probably damaging Het
Mre11a A T 9: 14,707,101 (GRCm39) N117Y probably damaging Het
Mrgprb1 A T 7: 48,097,076 (GRCm39) S279T possibly damaging Het
Myh13 T G 11: 67,241,064 (GRCm39) S814A probably benign Het
Ncapd2 A G 6: 125,153,678 (GRCm39) V679A possibly damaging Het
Nipbl A T 15: 8,379,771 (GRCm39) V1007D probably damaging Het
Nlrp12 T A 7: 3,277,049 (GRCm39) H960L probably damaging Het
Or3a1c T A 11: 74,046,769 (GRCm39) M263K possibly damaging Het
Or4a72 C T 2: 89,405,558 (GRCm39) V171I probably benign Het
Or7e169 A G 9: 19,757,709 (GRCm39) S69P probably benign Het
Pklr A G 3: 89,050,545 (GRCm39) Y402C probably damaging Het
Prdm2 T C 4: 142,859,334 (GRCm39) T1319A possibly damaging Het
Rif1 T A 2: 51,982,358 (GRCm39) V541E probably damaging Het
Ryk T A 9: 102,758,855 (GRCm39) I248N possibly damaging Het
Shisa2 A T 14: 59,867,134 (GRCm39) I129F probably damaging Het
Snap25 T G 2: 136,611,973 (GRCm39) probably benign Het
Snx31 G A 15: 36,525,848 (GRCm39) P284S probably benign Het
Spata31g1 C T 4: 42,974,131 (GRCm39) Q1155* probably null Het
Tas2r140 A G 6: 40,469,154 (GRCm39) K328R possibly damaging Het
Tas2r140 T C 6: 133,032,213 (GRCm39) T182A probably benign Het
Thumpd2 G A 17: 81,372,387 (GRCm39) R35C probably damaging Het
Tnxb A T 17: 34,937,443 (GRCm39) N3811Y probably damaging Het
Tpte A C 8: 22,835,901 (GRCm39) N428T probably damaging Het
Trpm6 A G 19: 18,831,629 (GRCm39) D1498G probably benign Het
Tsc2 C T 17: 24,842,444 (GRCm39) probably benign Het
Ttn C T 2: 76,703,277 (GRCm39) probably benign Het
Wdr24 A G 17: 26,045,017 (GRCm39) I251V probably benign Het
Zfat A G 15: 67,990,783 (GRCm39) probably null Het
Zfp442 A T 2: 150,250,042 (GRCm39) V620E possibly damaging Het
Zfp788 A G 7: 41,298,984 (GRCm39) H540R probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 128,856,747 (GRCm39) missense probably benign 0.00
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 128,848,736 (GRCm39) missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1528:Zc3h6 UTSW 2 128,858,989 (GRCm39) missense probably benign 0.01
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 128,858,540 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2051:Zc3h6 UTSW 2 128,857,538 (GRCm39) missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 128,844,160 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128,835,372 (GRCm39) intron probably benign
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9076:Zc3h6 UTSW 2 128,859,096 (GRCm39) nonsense probably null
R9577:Zc3h6 UTSW 2 128,858,102 (GRCm39) missense
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCCCAGTTAAGTGAGTAGAATCAG -3'
(R):5'- CCAATTGTTGCCATCTCAGAATAC -3'

Sequencing Primer
(F):5'- AGCCAACTTATACTACTTTCCAGATC -3'
(R):5'- CACTATTGCAACTATGAGCA -3'
Posted On 2014-08-25