Incidental Mutation 'R2030:Pklr'
ID221106
Institutional Source Beutler Lab
Gene Symbol Pklr
Ensembl Gene ENSMUSG00000041237
Gene Namepyruvate kinase liver and red blood cell
SynonymsPk1, R-PK, Pk-1
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89136142-89146784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89143238 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 402 (Y402C)
Ref Sequence ENSEMBL: ENSMUSP00000103106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029686] [ENSMUST00000047111] [ENSMUST00000107482] [ENSMUST00000127058]
Predicted Effect probably benign
Transcript: ENSMUST00000029686
SMART Domains Protein: ENSMUSP00000029686
Gene: ENSMUSG00000028051

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
Pfam:Ion_trans_N 48 91 1.3e-22 PFAM
Pfam:Ion_trans 92 357 3.7e-25 PFAM
low complexity region 358 369 N/A INTRINSIC
Blast:cNMP 370 402 7e-14 BLAST
cNMP 427 540 2.32e-20 SMART
Blast:cNMP 548 588 2e-17 BLAST
low complexity region 636 656 N/A INTRINSIC
low complexity region 698 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047111
AA Change: Y433C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035417
Gene: ENSMUSG00000041237
AA Change: Y433C

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:PK 85 438 6.9e-165 PFAM
Pfam:PK_C 453 571 3.6e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107482
AA Change: Y402C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103106
Gene: ENSMUSG00000041237
AA Change: Y402C

DomainStartEndE-ValueType
Pfam:PK 54 407 3.1e-163 PFAM
Pfam:PK_C 421 541 4.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127058
SMART Domains Protein: ENSMUSP00000119392
Gene: ENSMUSG00000041237

DomainStartEndE-ValueType
Pfam:PK 21 72 7.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148097
Meta Mutation Damage Score 0.4521 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyruvate kinase that catalyzes the transphosphorylation of phohsphoenolpyruvate into pyruvate and ATP, which is the rate-limiting step of glycolysis. Defects in this enzyme, due to gene mutations or genetic variations, are the common cause of chronic hereditary nonspherocytic hemolytic anemia (CNSHA or HNSHA). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for loss of function mutations in this gene suffer from hemolytic anemia. This is also a candidate gene for malaria resistance QTL Char4 and immunity to Salmonella typhimurium QTL Ity4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Pklr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Pklr APN 3 89144995 missense probably damaging 1.00
IGL02108:Pklr APN 3 89137403 missense probably damaging 1.00
IGL03030:Pklr APN 3 89142656 missense probably damaging 1.00
IGL03401:Pklr APN 3 89142729 missense probably benign 0.41
R0088:Pklr UTSW 3 89141908 missense probably damaging 1.00
R0801:Pklr UTSW 3 89145522 nonsense probably null
R1061:Pklr UTSW 3 89144881 missense probably damaging 1.00
R1434:Pklr UTSW 3 89143035 missense probably damaging 1.00
R2131:Pklr UTSW 3 89142660 missense probably damaging 1.00
R3703:Pklr UTSW 3 89142701 missense probably damaging 1.00
R4372:Pklr UTSW 3 89145523 nonsense probably null
R5279:Pklr UTSW 3 89143259 missense probably damaging 1.00
R5401:Pklr UTSW 3 89141866 missense probably damaging 1.00
R5809:Pklr UTSW 3 89141784 missense probably benign
R5946:Pklr UTSW 3 89136196 missense probably benign 0.43
R6331:Pklr UTSW 3 89137355 missense probably damaging 0.99
R7559:Pklr UTSW 3 89143058 missense probably damaging 1.00
R7711:Pklr UTSW 3 89141342 missense probably damaging 1.00
R7848:Pklr UTSW 3 89142978 missense possibly damaging 0.81
R7943:Pklr UTSW 3 89141507 missense probably damaging 0.99
R8145:Pklr UTSW 3 89145488 missense probably benign
R8953:Pklr UTSW 3 89142305 missense probably damaging 1.00
Z1176:Pklr UTSW 3 89144855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTGTATCATGCTGTCTGG -3'
(R):5'- TGGCCTCTAGAGTCCATAGC -3'

Sequencing Primer
(F):5'- TCTGGAGAGACCGCCAAAG -3'
(R):5'- GGCCTCTAGAGTCCATAGCTATCC -3'
Posted On2014-08-25