Incidental Mutation 'R2030:Kcnd3'
ID221108
Institutional Source Beutler Lab
Gene Symbol Kcnd3
Ensembl Gene ENSMUSG00000040896
Gene Namepotassium voltage-gated channel, Shal-related family, member 3
SynonymsKv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105452330-105674002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105459537 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 241 (Y241C)
Ref Sequence ENSEMBL: ENSMUSP00000113436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]
Predicted Effect probably damaging
Transcript: ENSMUST00000079169
AA Change: Y241C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: Y241C

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098761
AA Change: Y241C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: Y241C

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118360
AA Change: Y241C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: Y241C

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141694
Meta Mutation Damage Score 0.9708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Kcnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Kcnd3 APN 3 105667001 nonsense probably null
PIT4498001:Kcnd3 UTSW 3 105658709 missense probably damaging 0.99
R0483:Kcnd3 UTSW 3 105459626 missense probably damaging 1.00
R0544:Kcnd3 UTSW 3 105658759 missense probably damaging 1.00
R1457:Kcnd3 UTSW 3 105668186 missense probably benign 0.00
R1853:Kcnd3 UTSW 3 105459752 missense probably damaging 1.00
R2077:Kcnd3 UTSW 3 105666999 missense probably benign 0.16
R2106:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2287:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2288:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2316:Kcnd3 UTSW 3 105669126 missense probably benign 0.17
R2909:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2924:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2925:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3014:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3016:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3038:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3696:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3697:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3698:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3777:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3778:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3785:Kcnd3 UTSW 3 105668225 missense possibly damaging 0.79
R3810:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3811:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3815:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3816:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3819:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3877:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3879:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3899:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4300:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4367:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4370:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4491:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4549:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4550:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4569:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4571:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4593:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4594:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4595:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4624:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4625:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4627:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4630:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4631:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4632:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4799:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4822:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R5021:Kcnd3 UTSW 3 105658754 missense probably damaging 1.00
R5056:Kcnd3 UTSW 3 105666928 intron probably benign
R5849:Kcnd3 UTSW 3 105458795 utr 5 prime probably benign
R7198:Kcnd3 UTSW 3 105459540 missense probably damaging 1.00
R7224:Kcnd3 UTSW 3 105669084 missense probably damaging 0.98
R7532:Kcnd3 UTSW 3 105668210 missense probably damaging 1.00
R7578:Kcnd3 UTSW 3 105459617 missense probably benign 0.08
R7975:Kcnd3 UTSW 3 105458994 missense probably damaging 1.00
R8022:Kcnd3 UTSW 3 105458873 missense probably benign 0.19
R8823:Kcnd3 UTSW 3 105667014 missense probably benign 0.00
Z1177:Kcnd3 UTSW 3 105459570 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTCTTCTACTATGTGACTGGCTTC -3'
(R):5'- ACAGCTCTTCAGGGTGTAGC -3'

Sequencing Primer
(F):5'- ACTATGTGACTGGCTTCTTCATTG -3'
(R):5'- ATCCGTAGACCCTGGGAATGTC -3'
Posted On2014-08-25