Mutagenetix > Incidental Mutation

Incidental Mutation 'R1972:Stab2'

221109

Institutional Source

Beutler Lab

Gene Symbol

Stab2

Ensembl Gene

ENSMUSG00000035459

Gene Name

stabilin 2

Synonyms

STAB-2, FEEL-2

MMRRC Submission

039985-MU

Accession Numbers

Genbank: NM_138673; MGI: 2178743

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86841198-87008025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86960316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 356 (C356S)

Ref Sequence

ENSEMBL: ENSMUSP00000048309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035288]

AlphaFold

Q8R4U0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035288
AA Change: C356S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: C356S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EGF	119	156	1.85e0	SMART
EGF	167	201	2.43e1	SMART
EGF	206	244	1.43e-1	SMART
EGF	248	284	3.82e-2	SMART
EGF	333	370	2.02e-1	SMART
FAS1	414	515	1.06e-8	SMART
FAS1	561	662	3.54e-19	SMART
EGF	746	783	6.76e-3	SMART
EGF	836	873	1.31e0	SMART
EGF	877	917	2.99e-4	SMART
EGF	921	960	3.51e-1	SMART
EGF	964	1002	1.99e0	SMART
FAS1	1038	1138	1.73e-13	SMART
FAS1	1181	1276	1.83e-12	SMART
EGF	1354	1391	6.92e0	SMART
EGF	1401	1435	1.11e1	SMART
EGF	1442	1477	3.01e0	SMART
EGF	1481	1519	1.64e-1	SMART
EGF	1523	1561	1.14e0	SMART
EGF	1565	1603	5.62e0	SMART
FAS1	1638	1734	2.23e-25	SMART
FAS1	1785	1891	6.92e-22	SMART
EGF	1966	2006	1.95e1	SMART
EGF_like	1977	2017	2.46e-1	SMART
EGF	2016	2050	1.14e0	SMART
EGF	2058	2089	1.56e1	SMART
EGF	2093	2130	1.36e1	SMART
EGF	2134	2173	2.13e0	SMART
LINK	2204	2298	2.08e-29	SMART
FAS1	2363	2455	3.19e-12	SMART
transmembrane domain	2467	2489	N/A	INTRINSIC

Meta Mutation Damage Score

0.9266

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adat1	A	G	8: 111,990,418		probably benign	Het
Bbs2	A	G	8: 94,081,177		probably benign	Het
Bcl9	A	C	3: 97,207,202	D1035E	probably damaging	Het
Bmpr2	A	G	1: 59,813,603	E31G	possibly damaging	Het
Borcs5	A	G	6: 134,710,174	D164G	probably damaging	Het
Cap2	A	G	13: 46,637,899	R181G	probably damaging	Het
Ccdc113	A	T	8: 95,538,246	H128L	probably benign	Het
Cdh7	G	A	1: 110,061,132	V255I	probably benign	Het
Chat	C	T	14: 32,424,191	V342I	probably benign	Het
Chrm4	C	T	2: 91,927,493	A82V	probably benign	Het
Cyp2d22	A	T	15: 82,375,827	M52K	probably benign	Het
Dennd2c	T	C	3: 103,131,698	V54A	probably benign	Het
Dgka	C	T	10: 128,720,466	G717D	probably damaging	Het
Dnah1	C	T	14: 31,265,391	W3550*	probably null	Het
Eif2ak1	A	G	5: 143,884,714	T283A	probably benign	Het
Fam189a1	A	T	7: 64,775,768	I192N	possibly damaging	Het
Fcgbp	A	T	7: 28,094,192	Y1173F	probably benign	Het
Flt1	G	A	5: 147,655,093		probably benign	Het
Gpr149	T	C	3: 62,530,795	K647R	probably benign	Het
Gsdma2	T	C	11: 98,650,918	V157A	probably benign	Het
Heatr4	T	A	12: 83,955,020	I884F	probably damaging	Het
Il17ra	A	G	6: 120,482,216	E776G	probably benign	Het
Inpp5d	T	C	1: 87,676,314	S235P	probably benign	Het
Iqgap3	T	A	3: 88,083,928		probably null	Het
Isoc2a	T	A	7: 4,892,087	D171E	probably damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Kcnk12	T	C	17: 87,797,132	D108G	possibly damaging	Het
Klra9	A	T	6: 130,182,382		probably null	Het
Lgmn	A	G	12: 102,395,821		probably benign	Het
Morf4l1	A	T	9: 90,095,214		probably benign	Het
Mthfr	T	C	4: 148,051,927	I380T	probably damaging	Het
Mybpc1	T	C	10: 88,551,542	I436V	probably benign	Het
Naip5	A	G	13: 100,212,770	V1350A	probably damaging	Het
Neil2	A	T	14: 63,186,077	C36S	possibly damaging	Het
Nlrx1	A	G	9: 44,253,456	V897A	probably benign	Het
Nod2	A	T	8: 88,652,873	M8L	probably damaging	Het
Nop2	A	G	6: 125,134,639	T112A	probably benign	Het
Nrap	T	A	19: 56,357,353	T608S	probably damaging	Het
Nuak2	A	T	1: 132,330,602	H257L	probably damaging	Het
Olfr1218	A	T	2: 89,054,547	M293K	probably benign	Het
Olfr1475	T	C	19: 13,479,694	N168S	probably benign	Het
Olfr209	A	T	16: 59,362,113	V35D	probably damaging	Het
Olfr417	T	C	1: 174,369,570	F218L	probably benign	Het
Olfr671	T	C	7: 104,975,899	I33V	possibly damaging	Het
Olfr693	T	C	7: 106,678,219	D89G	probably benign	Het
Olfr889	T	A	9: 38,116,567	M257K	possibly damaging	Het
Pde1a	T	C	2: 79,865,721	E358G	probably damaging	Het
Pdlim1	A	T	19: 40,223,137	S237R	probably damaging	Het
Pithd1	T	C	4: 135,987,029	D36G	probably damaging	Het
Ppp2r3a	A	G	9: 101,211,777	F449S	probably benign	Het
Prr11	G	A	11: 87,098,754	R264C	possibly damaging	Het
Rbm43	A	T	2: 51,925,536	H224Q	probably benign	Het
Rfx5	C	T	3: 94,957,292	L250F	probably damaging	Het
Rgs22	T	A	15: 36,103,836	I160L	probably benign	Het
Rorb	T	A	19: 18,952,203	Q393H	probably damaging	Het
Rpl13a	T	A	7: 45,125,995	K368*	probably null	Het
Scaf8	T	G	17: 3,169,371	S276R	unknown	Het
Scube2	A	T	7: 109,809,214	N675K	probably benign	Het
Sec22c	A	T	9: 121,688,254	M126K	possibly damaging	Het
Serpinb11	T	C	1: 107,369,480	F29L	probably damaging	Het
Sis	A	G	3: 72,921,004	F1217S	probably damaging	Het
Slc18a2	A	G	19: 59,274,653	D294G	possibly damaging	Het
Slc9c1	A	G	16: 45,593,472	T988A	possibly damaging	Het
Smndc1	A	C	19: 53,383,555		probably null	Het
Sned1	G	A	1: 93,265,073	G361S	probably damaging	Het
Spatc1	A	T	15: 76,284,875		probably null	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Tbc1d30	A	T	10: 121,306,230		probably null	Het
Tenm3	T	C	8: 48,228,591	E2668G	probably damaging	Het
Tigar	A	G	6: 127,087,926	V253A	possibly damaging	Het
Tmc2	T	A	2: 130,214,664		probably benign	Het
Ttc26	C	A	6: 38,410,803	N396K	probably benign	Het
Ugt1a10	A	T	1: 88,056,047	Y189F	probably damaging	Het
Vmn2r82	A	G	10: 79,378,846	D221G	probably damaging	Het
Xkr5	C	T	8: 18,941,981	V131M	probably damaging	Het

Other mutations in Stab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Stab2	APN	10	86869206	splice site	probably null
IGL00809:Stab2	APN	10	86848174	splice site	probably benign
IGL00911:Stab2	APN	10	86969753	missense	probably damaging	1.00
IGL01347:Stab2	APN	10	86901703	splice site	probably null
IGL01411:Stab2	APN	10	86980008	splice site	probably benign
IGL01503:Stab2	APN	10	86940613	splice site	probably benign
IGL01599:Stab2	APN	10	86922895	missense	probably damaging	1.00
IGL01635:Stab2	APN	10	86981128	missense	probably benign	0.04
IGL01640:Stab2	APN	10	86954171	missense	probably benign	0.09
IGL01671:Stab2	APN	10	86969277	missense	possibly damaging	0.80
IGL02023:Stab2	APN	10	86871831	missense	possibly damaging	0.67
IGL02075:Stab2	APN	10	86967650	missense	possibly damaging	0.71
IGL02174:Stab2	APN	10	86859742	splice site	probably null
IGL02600:Stab2	APN	10	86954259	missense	probably damaging	1.00
IGL02666:Stab2	APN	10	86850902	missense	possibly damaging	0.67
IGL02668:Stab2	APN	10	86846163	splice site	probably benign
IGL02709:Stab2	APN	10	86846165	splice site	probably benign
IGL02728:Stab2	APN	10	86856556	missense	possibly damaging	0.95
IGL02803:Stab2	APN	10	86950269	splice site	probably benign
IGL02938:Stab2	APN	10	86871921	missense	possibly damaging	0.77
IGL03033:Stab2	APN	10	86996803	critical splice donor site	probably null
IGL03238:Stab2	APN	10	86855121	missense	probably damaging	1.00
IGL03402:Stab2	APN	10	86969301	missense	probably benign	0.03
prospector	UTSW	10	86901567	splice site	probably null
songbird	UTSW	10	86858152	missense	probably damaging	1.00
3-1:Stab2	UTSW	10	86869177	missense	probably damaging	0.96
F6893:Stab2	UTSW	10	86855171	missense	probably damaging	1.00
K7371:Stab2	UTSW	10	86943289	critical splice donor site	probably null
PIT4142001:Stab2	UTSW	10	86867175	missense	possibly damaging	0.94
PIT4362001:Stab2	UTSW	10	86861435	nonsense	probably null
R0015:Stab2	UTSW	10	86843617	missense	probably benign
R0254:Stab2	UTSW	10	86897960	missense	probably benign
R0310:Stab2	UTSW	10	86967613	splice site	probably benign
R0333:Stab2	UTSW	10	86841627	missense	probably benign
R0391:Stab2	UTSW	10	86947144	missense	probably benign	0.27
R0400:Stab2	UTSW	10	86872610	missense	probably damaging	1.00
R0433:Stab2	UTSW	10	86843491	splice site	probably benign
R0440:Stab2	UTSW	10	86949928	missense	probably benign	0.23
R0743:Stab2	UTSW	10	86887895	missense	probably damaging	1.00
R0847:Stab2	UTSW	10	86969871	missense	probably benign	0.00
R0883:Stab2	UTSW	10	86924450	splice site	probably benign
R1078:Stab2	UTSW	10	86907133	splice site	probably null
R1118:Stab2	UTSW	10	86885718	splice site	probably null
R1119:Stab2	UTSW	10	86859755	missense	possibly damaging	0.51
R1179:Stab2	UTSW	10	86950301	missense	probably damaging	0.98
R1440:Stab2	UTSW	10	86861367	splice site	probably null
R1550:Stab2	UTSW	10	86878926	missense	probably benign	0.01
R1616:Stab2	UTSW	10	86885718	splice site	probably null
R1728:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1768:Stab2	UTSW	10	87003008	missense	probably damaging	1.00
R1772:Stab2	UTSW	10	86954234	missense	probably benign	0.06
R1776:Stab2	UTSW	10	86957816	missense	possibly damaging	0.92
R1784:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1892:Stab2	UTSW	10	86938049	missense	probably damaging	0.99
R1957:Stab2	UTSW	10	86861470	missense	probably benign	0.13
R1975:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1976:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1996:Stab2	UTSW	10	87003031	missense	probably damaging	1.00
R2085:Stab2	UTSW	10	86954159	missense	probably damaging	1.00
R2149:Stab2	UTSW	10	86865040	nonsense	probably null
R2169:Stab2	UTSW	10	86887862	missense	probably damaging	1.00
R2201:Stab2	UTSW	10	86940639	missense	probably benign	0.22
R2296:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2297:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2298:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2326:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2434:Stab2	UTSW	10	86969319	missense	possibly damaging	0.78
R2519:Stab2	UTSW	10	86934840	splice site	probably benign
R2696:Stab2	UTSW	10	86861499	missense	probably benign	0.45
R2883:Stab2	UTSW	10	86967686	missense	possibly damaging	0.92
R2923:Stab2	UTSW	10	86861461	missense	probably damaging	1.00
R3711:Stab2	UTSW	10	86866708	missense	probably damaging	1.00
R3787:Stab2	UTSW	10	86969277	missense	possibly damaging	0.50
R3834:Stab2	UTSW	10	86949912	missense	possibly damaging	0.87
R3970:Stab2	UTSW	10	86878886	missense	probably damaging	0.97
R3979:Stab2	UTSW	10	86863456	missense	possibly damaging	0.56
R4003:Stab2	UTSW	10	86858124	missense	probably damaging	1.00
R4088:Stab2	UTSW	10	86922185	missense	probably damaging	1.00
R4151:Stab2	UTSW	10	87002983	missense	probably benign	0.12
R4190:Stab2	UTSW	10	86878944	missense	probably damaging	0.98
R4556:Stab2	UTSW	10	86967679	missense	possibly damaging	0.95
R4773:Stab2	UTSW	10	86907371	nonsense	probably null
R4825:Stab2	UTSW	10	86947147	missense	probably benign	0.08
R4865:Stab2	UTSW	10	86843500	splice site	probably null
R4871:Stab2	UTSW	10	86942235	missense	probably damaging	0.99
R4943:Stab2	UTSW	10	86954162	missense	probably damaging	0.99
R4981:Stab2	UTSW	10	86960223	missense	probably benign
R4994:Stab2	UTSW	10	86949907	missense	probably benign
R4999:Stab2	UTSW	10	86937909	missense	probably damaging	0.97
R5061:Stab2	UTSW	10	86907385	missense	probably damaging	1.00
R5072:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5073:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5074:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5134:Stab2	UTSW	10	86871810	splice site	probably null
R5213:Stab2	UTSW	10	86907197	missense	probably damaging	0.99
R5508:Stab2	UTSW	10	86960279	missense	probably benign	0.01
R5530:Stab2	UTSW	10	86947162	missense	probably benign	0.04
R5540:Stab2	UTSW	10	86848125	missense	probably benign	0.30
R5839:Stab2	UTSW	10	86872691	missense	probably damaging	0.97
R5949:Stab2	UTSW	10	86969849	missense	possibly damaging	0.87
R6015:Stab2	UTSW	10	86938042	missense	probably damaging	0.99
R6019:Stab2	UTSW	10	87003022	missense	probably benign	0.00
R6116:Stab2	UTSW	10	86907190	missense	probably damaging	1.00
R6131:Stab2	UTSW	10	86883778	splice site	probably null
R6209:Stab2	UTSW	10	86923003	missense	possibly damaging	0.94
R6243:Stab2	UTSW	10	86907161	missense	probably damaging	1.00
R6433:Stab2	UTSW	10	86901567	splice site	probably null
R6787:Stab2	UTSW	10	86919084	missense	probably benign	0.07
R6841:Stab2	UTSW	10	86942190	missense	probably damaging	1.00
R6873:Stab2	UTSW	10	86861366	critical splice donor site	probably null
R7025:Stab2	UTSW	10	86850837	missense	probably damaging	1.00
R7043:Stab2	UTSW	10	86870246	missense	probably damaging	0.99
R7047:Stab2	UTSW	10	86858152	missense	probably damaging	1.00
R7107:Stab2	UTSW	10	86905592	missense	possibly damaging	0.96
R7214:Stab2	UTSW	10	86899841	missense	probably damaging	0.99
R7271:Stab2	UTSW	10	87003108	splice site	probably null
R7291:Stab2	UTSW	10	86946220	missense	probably damaging	0.96
R7336:Stab2	UTSW	10	86969185	nonsense	probably null
R7432:Stab2	UTSW	10	86885683	missense	probably damaging	0.99
R7580:Stab2	UTSW	10	86869164	missense	probably benign	0.00
R7622:Stab2	UTSW	10	86873902	missense	possibly damaging	0.65
R7629:Stab2	UTSW	10	86883782	critical splice donor site	probably null
R7658:Stab2	UTSW	10	86981135	missense	probably benign	0.12
R7798:Stab2	UTSW	10	86957912	missense	probably damaging	0.98
R7835:Stab2	UTSW	10	86872619	missense	probably benign	0.06
R7845:Stab2	UTSW	10	86996894	missense	probably benign	0.09
R7863:Stab2	UTSW	10	86972881	missense	probably benign	0.30
R7885:Stab2	UTSW	10	86878912	missense	probably benign	0.03
R7904:Stab2	UTSW	10	86954192	nonsense	probably null
R7947:Stab2	UTSW	10	86846033	missense	probably benign	0.31
R7963:Stab2	UTSW	10	86848023	critical splice donor site	probably null
R8014:Stab2	UTSW	10	86850903	missense	possibly damaging	0.78
R8021:Stab2	UTSW	10	86905539	missense	possibly damaging	0.69
R8024:Stab2	UTSW	10	86846052	missense	probably benign	0.34
R8097:Stab2	UTSW	10	86869095	missense	possibly damaging	0.86
R8281:Stab2	UTSW	10	86873864	missense	probably damaging	0.98
R8462:Stab2	UTSW	10	86967734	missense	possibly damaging	0.79
R8670:Stab2	UTSW	10	86940723	missense	probably damaging	1.00
R8692:Stab2	UTSW	10	86972930	missense	probably damaging	0.99
R8744:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8745:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8782:Stab2	UTSW	10	86899821	missense	probably benign	0.00
R8875:Stab2	UTSW	10	86996864	missense	probably damaging	1.00
R8978:Stab2	UTSW	10	86949918	missense	possibly damaging	0.64
R9141:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9248:Stab2	UTSW	10	86891617	missense	probably damaging	0.98
R9326:Stab2	UTSW	10	86955146	missense	probably damaging	1.00
R9426:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9568:Stab2	UTSW	10	86863556	missense	probably damaging	1.00
R9627:Stab2	UTSW	10	86957840	missense	probably damaging	0.98
R9635:Stab2	UTSW	10	86850787	nonsense	probably null
R9648:Stab2	UTSW	10	86856697	frame shift	probably null
R9649:Stab2	UTSW	10	86856697	frame shift	probably null
R9650:Stab2	UTSW	10	86856697	frame shift	probably null
R9726:Stab2	UTSW	10	86954231	missense	probably benign	0.00
R9756:Stab2	UTSW	10	86967689	missense	possibly damaging	0.50
R9786:Stab2	UTSW	10	86922133	missense	probably benign	0.03
RF061:Stab2	UTSW	10	86866758	critical splice acceptor site	probably benign
X0023:Stab2	UTSW	10	86922198	critical splice acceptor site	probably null
X0025:Stab2	UTSW	10	86887816	missense	probably damaging	1.00
Z1176:Stab2	UTSW	10	86949914	missense	probably damaging	0.99
Z1177:Stab2	UTSW	10	86896596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGCACCAGCCTTGTCTGTC -3'
(R):5'- CCCTAAGCCAGGTTCTACAC -3'

Sequencing Primer
(F):5'- ACTTGTATCTAGCAGATGCCCTGG -3'
(R):5'- AAGCCAGGTTCTACACTTGACTG -3'

Posted On

2014-08-25