Incidental Mutation 'R1972:Mybpc1'
ID 221111
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Name myosin binding protein C, slow-type
Synonyms Slow-type C-protein, 8030451F13Rik
MMRRC Submission 039985-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R1972 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 88354141-88441014 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88387404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 436 (I436V)
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
AlphaFold A0A571BEN1
Predicted Effect probably benign
Transcript: ENSMUST00000119185
AA Change: I422V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: I422V

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121629
AA Change: I436V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: I436V

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156573
AA Change: I61V
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: I61V

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 112,717,050 (GRCm39) probably benign Het
Bbs2 A G 8: 94,807,805 (GRCm39) probably benign Het
Bcl9 A C 3: 97,114,518 (GRCm39) D1035E probably damaging Het
Bmpr2 A G 1: 59,852,762 (GRCm39) E31G possibly damaging Het
Borcs5 A G 6: 134,687,137 (GRCm39) D164G probably damaging Het
Cap2 A G 13: 46,791,375 (GRCm39) R181G probably damaging Het
Ccdc113 A T 8: 96,264,874 (GRCm39) H128L probably benign Het
Cdh20 G A 1: 109,988,862 (GRCm39) V255I probably benign Het
Chat C T 14: 32,146,148 (GRCm39) V342I probably benign Het
Chrm4 C T 2: 91,757,838 (GRCm39) A82V probably benign Het
Cyp2d22 A T 15: 82,260,028 (GRCm39) M52K probably benign Het
Dennd2c T C 3: 103,039,014 (GRCm39) V54A probably benign Het
Dgka C T 10: 128,556,335 (GRCm39) G717D probably damaging Het
Dnah1 C T 14: 30,987,348 (GRCm39) W3550* probably null Het
Eif2ak1 A G 5: 143,821,532 (GRCm39) T283A probably benign Het
Entrep2 A T 7: 64,425,516 (GRCm39) I192N possibly damaging Het
Fcgbp A T 7: 27,793,617 (GRCm39) Y1173F probably benign Het
Flt1 G A 5: 147,591,903 (GRCm39) probably benign Het
Gpr149 T C 3: 62,438,216 (GRCm39) K647R probably benign Het
Gsdma2 T C 11: 98,541,744 (GRCm39) V157A probably benign Het
Heatr4 T A 12: 84,001,794 (GRCm39) I884F probably damaging Het
Ift56 C A 6: 38,387,738 (GRCm39) N396K probably benign Het
Il17ra A G 6: 120,459,177 (GRCm39) E776G probably benign Het
Inpp5d T C 1: 87,604,036 (GRCm39) S235P probably benign Het
Iqgap3 T A 3: 87,991,235 (GRCm39) probably null Het
Isoc2a T A 7: 4,895,086 (GRCm39) D171E probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Kcnk12 T C 17: 88,104,560 (GRCm39) D108G possibly damaging Het
Klra9 A T 6: 130,159,345 (GRCm39) probably null Het
Lgmn A G 12: 102,362,080 (GRCm39) probably benign Het
Morf4l1 A T 9: 89,977,267 (GRCm39) probably benign Het
Mthfr T C 4: 148,136,384 (GRCm39) I380T probably damaging Het
Naip5 A G 13: 100,349,278 (GRCm39) V1350A probably damaging Het
Neil2 A T 14: 63,423,526 (GRCm39) C36S possibly damaging Het
Nlrx1 A G 9: 44,164,753 (GRCm39) V897A probably benign Het
Nod2 A T 8: 89,379,501 (GRCm39) M8L probably damaging Het
Nop2 A G 6: 125,111,602 (GRCm39) T112A probably benign Het
Nrap T A 19: 56,345,785 (GRCm39) T608S probably damaging Het
Nuak2 A T 1: 132,258,340 (GRCm39) H257L probably damaging Het
Or10x1 T C 1: 174,197,136 (GRCm39) F218L probably benign Het
Or2ag12 T C 7: 106,277,426 (GRCm39) D89G probably benign Het
Or4c113 A T 2: 88,884,891 (GRCm39) M293K probably benign Het
Or52e8 T C 7: 104,625,106 (GRCm39) I33V possibly damaging Het
Or5ac25 A T 16: 59,182,476 (GRCm39) V35D probably damaging Het
Or5b119 T C 19: 13,457,058 (GRCm39) N168S probably benign Het
Or8b40 T A 9: 38,027,863 (GRCm39) M257K possibly damaging Het
Pde1a T C 2: 79,696,065 (GRCm39) E358G probably damaging Het
Pdlim1 A T 19: 40,211,581 (GRCm39) S237R probably damaging Het
Pithd1 T C 4: 135,714,340 (GRCm39) D36G probably damaging Het
Ppp2r3d A G 9: 101,088,976 (GRCm39) F449S probably benign Het
Prr11 G A 11: 86,989,580 (GRCm39) R264C possibly damaging Het
Rbm43 A T 2: 51,815,548 (GRCm39) H224Q probably benign Het
Rfx5 C T 3: 94,864,603 (GRCm39) L250F probably damaging Het
Rgs22 T A 15: 36,103,982 (GRCm39) I160L probably benign Het
Rorb T A 19: 18,929,567 (GRCm39) Q393H probably damaging Het
Rpl13a T A 7: 44,775,419 (GRCm39) K368* probably null Het
Scaf8 T G 17: 3,219,646 (GRCm39) S276R unknown Het
Scube2 A T 7: 109,408,421 (GRCm39) N675K probably benign Het
Sec22c A T 9: 121,517,320 (GRCm39) M126K possibly damaging Het
Serpinb11 T C 1: 107,297,210 (GRCm39) F29L probably damaging Het
Sis A G 3: 72,828,337 (GRCm39) F1217S probably damaging Het
Slc18a2 A G 19: 59,263,085 (GRCm39) D294G possibly damaging Het
Slc9c1 A G 16: 45,413,835 (GRCm39) T988A possibly damaging Het
Smndc1 A C 19: 53,371,986 (GRCm39) probably null Het
Sned1 G A 1: 93,192,795 (GRCm39) G361S probably damaging Het
Spatc1 A T 15: 76,169,075 (GRCm39) probably null Het
Stab2 A T 10: 86,796,180 (GRCm39) C356S probably damaging Het
Stk4 C T 2: 163,942,448 (GRCm39) T360M probably benign Het
Tbc1d30 A T 10: 121,142,135 (GRCm39) probably null Het
Tenm3 T C 8: 48,681,626 (GRCm39) E2668G probably damaging Het
Tigar A G 6: 127,064,889 (GRCm39) V253A possibly damaging Het
Tmc2 T A 2: 130,056,584 (GRCm39) probably benign Het
Ugt1a10 A T 1: 87,983,769 (GRCm39) Y189F probably damaging Het
Vmn2r82 A G 10: 79,214,680 (GRCm39) D221G probably damaging Het
Xkr5 C T 8: 18,991,997 (GRCm39) V131M probably damaging Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88,385,124 (GRCm39) missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88,372,246 (GRCm39) missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88,360,970 (GRCm39) splice site probably null
IGL00964:Mybpc1 APN 10 88,391,604 (GRCm39) critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88,406,507 (GRCm39) missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88,367,632 (GRCm39) missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88,372,290 (GRCm39) missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88,362,235 (GRCm39) missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88,376,822 (GRCm39) missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88,407,378 (GRCm39) splice site probably benign
R1321:Mybpc1 UTSW 10 88,406,463 (GRCm39) missense probably damaging 1.00
R1321:Mybpc1 UTSW 10 88,365,403 (GRCm39) missense possibly damaging 0.85
R1562:Mybpc1 UTSW 10 88,389,193 (GRCm39) missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88,389,157 (GRCm39) missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88,384,688 (GRCm39) missense probably damaging 1.00
R2006:Mybpc1 UTSW 10 88,381,921 (GRCm39) missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88,409,299 (GRCm39) nonsense probably null
R2129:Mybpc1 UTSW 10 88,387,314 (GRCm39) missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88,376,804 (GRCm39) splice site probably benign
R2200:Mybpc1 UTSW 10 88,391,557 (GRCm39) missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88,391,540 (GRCm39) missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88,387,269 (GRCm39) missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88,367,641 (GRCm39) missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88,406,521 (GRCm39) splice site probably null
R4032:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88,409,387 (GRCm39) nonsense probably null
R4821:Mybpc1 UTSW 10 88,384,727 (GRCm39) missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R4876:Mybpc1 UTSW 10 88,358,853 (GRCm39) missense probably benign
R4878:Mybpc1 UTSW 10 88,387,292 (GRCm39) missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88,391,586 (GRCm39) nonsense probably null
R4913:Mybpc1 UTSW 10 88,389,116 (GRCm39) critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88,391,525 (GRCm39) missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88,379,636 (GRCm39) missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88,381,926 (GRCm39) missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88,372,213 (GRCm39) missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88,358,876 (GRCm39) missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88,381,891 (GRCm39) missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88,406,428 (GRCm39) missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88,378,318 (GRCm39) missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88,404,481 (GRCm39) missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88,396,217 (GRCm39) missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88,389,139 (GRCm39) missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88,358,861 (GRCm39) missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88,372,243 (GRCm39) missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88,378,192 (GRCm39) nonsense probably null
R6972:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88,358,886 (GRCm39) missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88,389,274 (GRCm39) missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88,379,581 (GRCm39) missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88,385,209 (GRCm39) missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88,362,155 (GRCm39) missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88,385,187 (GRCm39) missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88,384,716 (GRCm39) missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88,378,234 (GRCm39) missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88,394,529 (GRCm39) missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88,358,865 (GRCm39) missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88,394,553 (GRCm39) missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88,409,359 (GRCm39) nonsense probably null
R8494:Mybpc1 UTSW 10 88,362,291 (GRCm39) missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88,407,447 (GRCm39) missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88,394,437 (GRCm39) missense probably benign 0.44
R9031:Mybpc1 UTSW 10 88,358,906 (GRCm39) missense probably damaging 0.99
R9061:Mybpc1 UTSW 10 88,391,501 (GRCm39) missense probably damaging 1.00
R9081:Mybpc1 UTSW 10 88,389,168 (GRCm39) missense probably damaging 1.00
R9172:Mybpc1 UTSW 10 88,379,615 (GRCm39) missense possibly damaging 0.93
R9323:Mybpc1 UTSW 10 88,360,829 (GRCm39) critical splice donor site probably null
R9460:Mybpc1 UTSW 10 88,372,197 (GRCm39) missense probably damaging 0.99
R9488:Mybpc1 UTSW 10 88,379,624 (GRCm39) missense possibly damaging 0.47
R9757:Mybpc1 UTSW 10 88,372,257 (GRCm39) missense probably damaging 1.00
R9796:Mybpc1 UTSW 10 88,406,497 (GRCm39) missense possibly damaging 0.56
Z1176:Mybpc1 UTSW 10 88,396,189 (GRCm39) missense probably benign
Z1177:Mybpc1 UTSW 10 88,409,299 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCGTGGATGCATCATTCAG -3'
(R):5'- TGTTACGCTAGGGTCTGCTC -3'

Sequencing Primer
(F):5'- GAAAAGTGCCTGTGGATAATTCCTGC -3'
(R):5'- CGGTTACATCCTCTATACTGGAG -3'
Posted On 2014-08-25