Incidental Mutation 'R1972:Mybpc1'
ID221111
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Namemyosin binding protein C, slow-type
Synonyms8030451F13Rik, Slow-type C-protein
MMRRC Submission 039985-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R1972 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88518279-88605152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88551542 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 436 (I436V)
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
Predicted Effect probably benign
Transcript: ENSMUST00000119185
AA Change: I422V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: I422V

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121629
AA Change: I436V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: I436V

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156573
AA Change: I61V
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: I61V

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,990,418 probably benign Het
Bbs2 A G 8: 94,081,177 probably benign Het
Bcl9 A C 3: 97,207,202 D1035E probably damaging Het
Bmpr2 A G 1: 59,813,603 E31G possibly damaging Het
Borcs5 A G 6: 134,710,174 D164G probably damaging Het
Cap2 A G 13: 46,637,899 R181G probably damaging Het
Ccdc113 A T 8: 95,538,246 H128L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chrm4 C T 2: 91,927,493 A82V probably benign Het
Cyp2d22 A T 15: 82,375,827 M52K probably benign Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dgka C T 10: 128,720,466 G717D probably damaging Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Eif2ak1 A G 5: 143,884,714 T283A probably benign Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Fcgbp A T 7: 28,094,192 Y1173F probably benign Het
Flt1 G A 5: 147,655,093 probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Gsdma2 T C 11: 98,650,918 V157A probably benign Het
Heatr4 T A 12: 83,955,020 I884F probably damaging Het
Il17ra A G 6: 120,482,216 E776G probably benign Het
Inpp5d T C 1: 87,676,314 S235P probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Isoc2a T A 7: 4,892,087 D171E probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kcnk12 T C 17: 87,797,132 D108G possibly damaging Het
Klra9 A T 6: 130,182,382 probably null Het
Lgmn A G 12: 102,395,821 probably benign Het
Morf4l1 A T 9: 90,095,214 probably benign Het
Mthfr T C 4: 148,051,927 I380T probably damaging Het
Naip5 A G 13: 100,212,770 V1350A probably damaging Het
Neil2 A T 14: 63,186,077 C36S possibly damaging Het
Nlrx1 A G 9: 44,253,456 V897A probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nop2 A G 6: 125,134,639 T112A probably benign Het
Nrap T A 19: 56,357,353 T608S probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Olfr1218 A T 2: 89,054,547 M293K probably benign Het
Olfr1475 T C 19: 13,479,694 N168S probably benign Het
Olfr209 A T 16: 59,362,113 V35D probably damaging Het
Olfr417 T C 1: 174,369,570 F218L probably benign Het
Olfr671 T C 7: 104,975,899 I33V possibly damaging Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Pde1a T C 2: 79,865,721 E358G probably damaging Het
Pdlim1 A T 19: 40,223,137 S237R probably damaging Het
Pithd1 T C 4: 135,987,029 D36G probably damaging Het
Ppp2r3a A G 9: 101,211,777 F449S probably benign Het
Prr11 G A 11: 87,098,754 R264C possibly damaging Het
Rbm43 A T 2: 51,925,536 H224Q probably benign Het
Rfx5 C T 3: 94,957,292 L250F probably damaging Het
Rgs22 T A 15: 36,103,836 I160L probably benign Het
Rorb T A 19: 18,952,203 Q393H probably damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Scaf8 T G 17: 3,169,371 S276R unknown Het
Scube2 A T 7: 109,809,214 N675K probably benign Het
Sec22c A T 9: 121,688,254 M126K possibly damaging Het
Serpinb11 T C 1: 107,369,480 F29L probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc18a2 A G 19: 59,274,653 D294G possibly damaging Het
Slc9c1 A G 16: 45,593,472 T988A possibly damaging Het
Smndc1 A C 19: 53,383,555 probably null Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spatc1 A T 15: 76,284,875 probably null Het
Stab2 A T 10: 86,960,316 C356S probably damaging Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tbc1d30 A T 10: 121,306,230 probably null Het
Tenm3 T C 8: 48,228,591 E2668G probably damaging Het
Tigar A G 6: 127,087,926 V253A possibly damaging Het
Tmc2 T A 2: 130,214,664 probably benign Het
Ttc26 C A 6: 38,410,803 N396K probably benign Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Vmn2r82 A G 10: 79,378,846 D221G probably damaging Het
Xkr5 C T 8: 18,941,981 V131M probably damaging Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88549262 missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88536384 missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88525108 splice site probably null
IGL00964:Mybpc1 APN 10 88555742 critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88570645 missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88531770 missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88536428 missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88526373 missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88540960 missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88571516 splice site probably benign
R1321:Mybpc1 UTSW 10 88529541 missense possibly damaging 0.85
R1321:Mybpc1 UTSW 10 88570601 missense probably damaging 1.00
R1562:Mybpc1 UTSW 10 88553331 missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88553295 missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88548826 missense probably damaging 1.00
R2006:Mybpc1 UTSW 10 88546059 missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88573437 nonsense probably null
R2129:Mybpc1 UTSW 10 88551452 missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88540942 splice site probably benign
R2200:Mybpc1 UTSW 10 88555695 missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88555678 missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88551407 missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88531779 missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88570659 splice site probably null
R4032:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88573525 nonsense probably null
R4821:Mybpc1 UTSW 10 88548865 missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88522991 missense probably benign
R4876:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R4878:Mybpc1 UTSW 10 88551430 missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88555724 nonsense probably null
R4913:Mybpc1 UTSW 10 88553254 critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88555663 missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88543774 missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88546064 missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88536351 missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88523014 missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88546029 missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88570566 missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88542456 missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88568619 missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88560355 missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88553277 missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88522999 missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88536381 missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88542330 nonsense probably null
R6972:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88523024 missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88553412 missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88543719 missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88549347 missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88526293 missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88549325 missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88548854 missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88542372 missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88558667 missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88523003 missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88558691 missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88573497 nonsense probably null
R8494:Mybpc1 UTSW 10 88526429 missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88571585 missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88558575 missense probably benign 0.44
Z1176:Mybpc1 UTSW 10 88560327 missense probably benign
Z1177:Mybpc1 UTSW 10 88573437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCGTGGATGCATCATTCAG -3'
(R):5'- TGTTACGCTAGGGTCTGCTC -3'

Sequencing Primer
(F):5'- GAAAAGTGCCTGTGGATAATTCCTGC -3'
(R):5'- CGGTTACATCCTCTATACTGGAG -3'
Posted On2014-08-25