Mutagenetix > Incidental Mutations

Incidental Mutation 'R2030:Prdm2'

221118

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

040037-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2030 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143132764 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1319 (T1319A)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105778
AA Change: T1319A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: T1319A

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197026

Meta Mutation Damage Score

0.3350

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	C	T	4: 42,974,131	Q1155*	probably null	Het
Adtrp	C	T	13: 41,828,259	V13I	probably damaging	Het
Ak2	A	G	4: 129,008,220	K229E	probably benign	Het
Atp13a4	A	T	16: 29,422,684	V741D	probably damaging	Het
Bdp1	A	T	13: 100,061,189	M896K	probably benign	Het
Ccser1	C	T	6: 61,311,563	R237C	probably benign	Het
Cdk7	A	G	13: 100,722,674		probably benign	Het
CK137956	A	G	4: 127,951,387	S188P	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dbndd2	A	G	2: 164,488,643	D72G	probably damaging	Het
Disp3	A	T	4: 148,259,966	I493N	probably damaging	Het
Epx	T	C	11: 87,864,824	D678G	probably damaging	Het
Fbxw5	G	T	2: 25,504,798	V235L	probably damaging	Het
Fmo4	T	A	1: 162,794,172	D490V	probably damaging	Het
Fuca2	A	G	10: 13,506,774	Y268C	probably damaging	Het
Gm4787	C	T	12: 81,378,770	V205I	probably damaging	Het
Gpat3	G	A	5: 100,897,821	R437K	probably benign	Het
Herc2	A	G	7: 56,184,373	S3109G	probably damaging	Het
Hr	G	A	14: 70,571,448	R1117H	probably damaging	Het
Htra4	T	A	8: 25,033,577	D324V	probably damaging	Het
Kcnd3	A	G	3: 105,459,537	Y241C	probably damaging	Het
Kcp	G	A	6: 29,489,072	L1072F	probably damaging	Het
Lrrc52	T	C	1: 167,466,459	N86D	probably benign	Het
Mindy4	A	G	6: 55,211,262	T26A	probably damaging	Het
Mre11a	A	T	9: 14,795,805	N117Y	probably damaging	Het
Mrgprb1	A	T	7: 48,447,328	S279T	possibly damaging	Het
Myh13	T	G	11: 67,350,238	S814A	probably benign	Het
Ncapd2	A	G	6: 125,176,715	V679A	possibly damaging	Het
Nipbl	A	T	15: 8,350,287	V1007D	probably damaging	Het
Nlrp12	T	A	7: 3,228,417	H960L	probably damaging	Het
Olfr1245	C	T	2: 89,575,214	V171I	probably benign	Het
Olfr402	T	A	11: 74,155,943	M263K	possibly damaging	Het
Olfr860	A	G	9: 19,846,413	S69P	probably benign	Het
Pklr	A	G	3: 89,143,238	Y402C	probably damaging	Het
Rif1	T	A	2: 52,092,346	V541E	probably damaging	Het
Ryk	T	A	9: 102,881,656	I248N	possibly damaging	Het
Shisa2	A	T	14: 59,629,685	I129F	probably damaging	Het
Snap25	T	G	2: 136,770,053		probably benign	Het
Snx31	G	A	15: 36,525,702	P284S	probably benign	Het
Tas2r137	A	G	6: 40,492,220	K328R	possibly damaging	Het
Tas2r140	T	C	6: 133,055,250	T182A	probably benign	Het
Thumpd2	G	A	17: 81,064,958	R35C	probably damaging	Het
Tnxb	A	T	17: 34,718,469	N3811Y	probably damaging	Het
Tpte	A	C	8: 22,345,885	N428T	probably damaging	Het
Trpm6	A	G	19: 18,854,265	D1498G	probably benign	Het
Tsc2	C	T	17: 24,623,470		probably benign	Het
Ttn	C	T	2: 76,872,933		probably benign	Het
Wdr24	A	G	17: 25,826,043	I251V	probably benign	Het
Wdr92	A	T	11: 17,229,832	T278S	probably benign	Het
Zc3h6	T	C	2: 129,006,086	Y278H	probably damaging	Het
Zfat	A	G	15: 68,118,934		probably null	Het
Zfp442	A	T	2: 150,408,122	V620E	possibly damaging	Het
Zfp788	A	G	7: 41,649,560	H540R	probably damaging	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTGTCTAAAACCAGCACTCC -3'
(R):5'- GAGTTTGCCAGAAGAGCCTG -3'

Sequencing Primer
(F):5'- AAACCAGCACTCCATTTTTGGG -3'
(R):5'- ATGACTCCTCTGAAGAGCTTTACACG -3'

Posted On

2014-08-25