Incidental Mutation 'R2030:Disp3'
ID221120
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Namedispatched RND transporter family member 3
SynonymsPtchd2, G630052C06Rik
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148240264-148287965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148259966 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 493 (I493N)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
Predicted Effect probably damaging
Transcript: ENSMUST00000047720
AA Change: I493N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: I493N

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143851
Meta Mutation Damage Score 0.8627 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148241534 missense probably benign 0.10
IGL01065:Disp3 APN 4 148261183 missense probably damaging 1.00
IGL01800:Disp3 APN 4 148249801 nonsense probably null
IGL01947:Disp3 APN 4 148260519 missense probably damaging 1.00
IGL02510:Disp3 APN 4 148252701 missense probably benign 0.00
IGL02573:Disp3 APN 4 148271449 missense probably damaging 1.00
IGL02728:Disp3 APN 4 148272038 missense probably damaging 1.00
IGL02931:Disp3 APN 4 148249201 missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0257:Disp3 UTSW 4 148250754 missense possibly damaging 0.87
R0409:Disp3 UTSW 4 148271959 missense probably damaging 1.00
R0557:Disp3 UTSW 4 148241404 missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148241590 missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148249825 missense probably benign 0.00
R1526:Disp3 UTSW 4 148259916 missense probably benign 0.00
R1791:Disp3 UTSW 4 148241518 missense probably damaging 1.00
R1856:Disp3 UTSW 4 148271632 missense probably damaging 1.00
R1987:Disp3 UTSW 4 148258753 missense probably damaging 0.97
R2271:Disp3 UTSW 4 148271602 missense possibly damaging 0.87
R2373:Disp3 UTSW 4 148258795 missense probably damaging 1.00
R2566:Disp3 UTSW 4 148241423 missense probably damaging 1.00
R3731:Disp3 UTSW 4 148252827 missense probably benign 0.03
R4359:Disp3 UTSW 4 148271932 missense probably benign 0.03
R4762:Disp3 UTSW 4 148272118 missense probably damaging 1.00
R4950:Disp3 UTSW 4 148258126 missense possibly damaging 0.94
R4975:Disp3 UTSW 4 148244216 missense possibly damaging 0.79
R5218:Disp3 UTSW 4 148242876 missense possibly damaging 0.88
R5523:Disp3 UTSW 4 148258097 missense probably benign 0.14
R5556:Disp3 UTSW 4 148258157 missense probably benign 0.14
R5857:Disp3 UTSW 4 148249183 missense probably benign 0.01
R5933:Disp3 UTSW 4 148241313 nonsense probably null
R5994:Disp3 UTSW 4 148254284 missense possibly damaging 0.94
R6362:Disp3 UTSW 4 148254308 missense possibly damaging 0.95
R6813:Disp3 UTSW 4 148259930 missense probably benign 0.09
R7211:Disp3 UTSW 4 148241522 missense probably damaging 0.98
R7470:Disp3 UTSW 4 148261070 missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148242866 missense probably damaging 0.99
R8093:Disp3 UTSW 4 148270516 missense possibly damaging 0.93
R8357:Disp3 UTSW 4 148261115 missense possibly damaging 0.86
R8457:Disp3 UTSW 4 148261115 missense possibly damaging 0.86
R8506:Disp3 UTSW 4 148241570 missense possibly damaging 0.77
Z1088:Disp3 UTSW 4 148271743 missense possibly damaging 0.63
Z1176:Disp3 UTSW 4 148250957 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148249746 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148249847 missense probably benign 0.01
Z1177:Disp3 UTSW 4 148250714 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148270567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGAGATGAAGGTGCTGG -3'
(R):5'- GTGCAGCCAAGAAATCTGGTG -3'

Sequencing Primer
(F):5'- TCAGGAGTCACCCACGTGTG -3'
(R):5'- AAATCTGGTGGATGGGGCC -3'
Posted On2014-08-25