Mutagenetix > Incidental Mutation

Incidental Mutation 'R2030:Kcp'

221126

Institutional Source

Beutler Lab

Gene Symbol

Kcp

Ensembl Gene

ENSMUSG00000059022

Gene Name

kielin/chordin-like protein

Synonyms

Crim2, KCP, LOC333088

MMRRC Submission

040037-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R2030 (G1)

Quality Score

188

Status

Validated

Chromosome

Chromosomal Location

29473162-29507952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 29489072 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1072 (L1072F)

Ref Sequence

ENSEMBL: ENSMUSP00000099135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]

AlphaFold

Q3U492

Predicted Effect

probably damaging
Transcript: ENSMUST00000078112
AA Change: L1072F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: L1072F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000091391
AA Change: L1071F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: L1071F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1082	6.53e-9	SMART
VWC	1089	1142	1.05e-3	SMART
VWC	1149	1206	2.93e-11	SMART
Pfam:VWD	1213	1253	4.6e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000101614
AA Change: L1072F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: L1072F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	8e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
VWD	1201	1362	6.09e-50	SMART
C8	1404	1479	1.55e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158018

Predicted Effect

probably damaging
Transcript: ENSMUST00000159479
AA Change: L342F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022
AA Change: L342F

Domain	Start	End	E-Value	Type
VWC	1	51	4.56e-1	SMART
VWC	54	110	1.98e-8	SMART
VWC	113	169	1.35e-1	SMART
VWC	172	228	5.77e-10	SMART
VWC	231	286	1.21e-3	SMART
VWC	289	353	6.53e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159482

Predicted Effect

probably benign
Transcript: ENSMUST00000161276

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161655

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (54/54)

MGI Phenotype

PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	C	T	4: 42,974,131	Q1155*	probably null	Het
Adtrp	C	T	13: 41,828,259	V13I	probably damaging	Het
Ak2	A	G	4: 129,008,220	K229E	probably benign	Het
Atp13a4	A	T	16: 29,422,684	V741D	probably damaging	Het
Bdp1	A	T	13: 100,061,189	M896K	probably benign	Het
Ccser1	C	T	6: 61,311,563	R237C	probably benign	Het
Cdk7	A	G	13: 100,722,674		probably benign	Het
CK137956	A	G	4: 127,951,387	S188P	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dbndd2	A	G	2: 164,488,643	D72G	probably damaging	Het
Disp3	A	T	4: 148,259,966	I493N	probably damaging	Het
Epx	T	C	11: 87,864,824	D678G	probably damaging	Het
Fbxw5	G	T	2: 25,504,798	V235L	probably damaging	Het
Fmo4	T	A	1: 162,794,172	D490V	probably damaging	Het
Fuca2	A	G	10: 13,506,774	Y268C	probably damaging	Het
Gm4787	C	T	12: 81,378,770	V205I	probably damaging	Het
Gpat3	G	A	5: 100,897,821	R437K	probably benign	Het
Herc2	A	G	7: 56,184,373	S3109G	probably damaging	Het
Hr	G	A	14: 70,571,448	R1117H	probably damaging	Het
Htra4	T	A	8: 25,033,577	D324V	probably damaging	Het
Kcnd3	A	G	3: 105,459,537	Y241C	probably damaging	Het
Lrrc52	T	C	1: 167,466,459	N86D	probably benign	Het
Mindy4	A	G	6: 55,211,262	T26A	probably damaging	Het
Mre11a	A	T	9: 14,795,805	N117Y	probably damaging	Het
Mrgprb1	A	T	7: 48,447,328	S279T	possibly damaging	Het
Myh13	T	G	11: 67,350,238	S814A	probably benign	Het
Ncapd2	A	G	6: 125,176,715	V679A	possibly damaging	Het
Nipbl	A	T	15: 8,350,287	V1007D	probably damaging	Het
Nlrp12	T	A	7: 3,228,417	H960L	probably damaging	Het
Olfr1245	C	T	2: 89,575,214	V171I	probably benign	Het
Olfr402	T	A	11: 74,155,943	M263K	possibly damaging	Het
Olfr860	A	G	9: 19,846,413	S69P	probably benign	Het
Pklr	A	G	3: 89,143,238	Y402C	probably damaging	Het
Prdm2	T	C	4: 143,132,764	T1319A	possibly damaging	Het
Rif1	T	A	2: 52,092,346	V541E	probably damaging	Het
Ryk	T	A	9: 102,881,656	I248N	possibly damaging	Het
Shisa2	A	T	14: 59,629,685	I129F	probably damaging	Het
Snap25	T	G	2: 136,770,053		probably benign	Het
Snx31	G	A	15: 36,525,702	P284S	probably benign	Het
Tas2r137	A	G	6: 40,492,220	K328R	possibly damaging	Het
Tas2r140	T	C	6: 133,055,250	T182A	probably benign	Het
Thumpd2	G	A	17: 81,064,958	R35C	probably damaging	Het
Tnxb	A	T	17: 34,718,469	N3811Y	probably damaging	Het
Tpte	A	C	8: 22,345,885	N428T	probably damaging	Het
Trpm6	A	G	19: 18,854,265	D1498G	probably benign	Het
Tsc2	C	T	17: 24,623,470		probably benign	Het
Ttn	C	T	2: 76,872,933		probably benign	Het
Wdr24	A	G	17: 25,826,043	I251V	probably benign	Het
Wdr92	A	T	11: 17,229,832	T278S	probably benign	Het
Zc3h6	T	C	2: 129,006,086	Y278H	probably damaging	Het
Zfat	A	G	15: 68,118,934		probably null	Het
Zfp442	A	T	2: 150,408,122	V620E	possibly damaging	Het
Zfp788	A	G	7: 41,649,560	H540R	probably damaging	Het

Other mutations in Kcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Kcp	APN	6	29482657	missense	probably benign
IGL01344:Kcp	APN	6	29498951	splice site	probably null
IGL01404:Kcp	APN	6	29496639	missense	probably damaging	0.99
IGL01735:Kcp	APN	6	29498879	missense	probably damaging	1.00
IGL01776:Kcp	APN	6	29497908	missense	probably damaging	1.00
IGL02092:Kcp	APN	6	29489032	critical splice donor site	probably null
IGL02252:Kcp	APN	6	29504549	missense	probably damaging	1.00
IGL02690:Kcp	APN	6	29484999	unclassified	probably benign
IGL02817:Kcp	APN	6	29496969	missense	probably damaging	0.97
IGL03074:Kcp	APN	6	29496631	missense	probably damaging	1.00
P0045:Kcp	UTSW	6	29498348	missense	probably damaging	1.00
R0219:Kcp	UTSW	6	29495785	missense	probably damaging	1.00
R0355:Kcp	UTSW	6	29496927	missense	possibly damaging	0.89
R0738:Kcp	UTSW	6	29490439	missense	probably benign	0.24
R1111:Kcp	UTSW	6	29485423	missense	probably benign
R1304:Kcp	UTSW	6	29501292	unclassified	probably benign
R1663:Kcp	UTSW	6	29498965	missense	possibly damaging	0.68
R1808:Kcp	UTSW	6	29505655	missense	probably benign	0.05
R1907:Kcp	UTSW	6	29497835	unclassified	probably benign
R2099:Kcp	UTSW	6	29496165	nonsense	probably null
R3411:Kcp	UTSW	6	29482846	missense	possibly damaging	0.68
R3982:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R3983:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R4223:Kcp	UTSW	6	29482258	missense	possibly damaging	0.55
R4377:Kcp	UTSW	6	29493203	missense	probably damaging	1.00
R4570:Kcp	UTSW	6	29491848	nonsense	probably null
R4624:Kcp	UTSW	6	29482814	missense	possibly damaging	0.94
R4694:Kcp	UTSW	6	29493197	missense	probably benign	0.29
R4750:Kcp	UTSW	6	29484626	missense	probably benign	0.03
R4968:Kcp	UTSW	6	29497629	nonsense	probably null
R5053:Kcp	UTSW	6	29496958	missense	probably benign	0.01
R5067:Kcp	UTSW	6	29492108	missense	probably benign	0.06
R5253:Kcp	UTSW	6	29498520	unclassified	probably benign
R5418:Kcp	UTSW	6	29504284	nonsense	probably null
R6020:Kcp	UTSW	6	29502864	missense	probably benign	0.03
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6088:Kcp	UTSW	6	29502632	missense	probably benign
R6178:Kcp	UTSW	6	29482888	missense	possibly damaging	0.68
R6285:Kcp	UTSW	6	29502365	missense	probably benign	0.21
R6310:Kcp	UTSW	6	29493258	missense	probably damaging	0.98
R6369:Kcp	UTSW	6	29484694	missense	probably damaging	1.00
R6860:Kcp	UTSW	6	29505720	missense	probably benign	0.19
R6949:Kcp	UTSW	6	29484612	splice site	probably null
R6962:Kcp	UTSW	6	29482840	missense	probably benign	0.08
R7006:Kcp	UTSW	6	29499170	missense	probably damaging	1.00
R7138:Kcp	UTSW	6	29491862	nonsense	probably null
R7141:Kcp	UTSW	6	29487512	nonsense	probably null
R7153:Kcp	UTSW	6	29499015	missense	probably damaging	1.00
R7162:Kcp	UTSW	6	29497200	splice site	probably null
R7334:Kcp	UTSW	6	29485512	missense	probably damaging	1.00
R7565:Kcp	UTSW	6	29499187	missense	probably damaging	1.00
R7671:Kcp	UTSW	6	29496517	missense	probably benign	0.02
R7766:Kcp	UTSW	6	29496847	missense	probably damaging	0.98
R7781:Kcp	UTSW	6	29497765	missense	probably damaging	1.00
R8702:Kcp	UTSW	6	29482751	missense	probably damaging	1.00
R9384:Kcp	UTSW	6	29496619	critical splice donor site	probably null
R9425:Kcp	UTSW	6	29489152	missense	probably benign
R9553:Kcp	UTSW	6	29485101	missense	probably null	1.00
R9752:Kcp	UTSW	6	29497755	missense	probably damaging	1.00
R9755:Kcp	UTSW	6	29492461	missense	probably damaging	1.00
Z1176:Kcp	UTSW	6	29485012	missense	probably benign	0.23
Z1177:Kcp	UTSW	6	29485525	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- AACAAGCTTTGCCAACTTAAGC -3'
(R):5'- TCTCTGGATTAGGAGCAAGCTGAC -3'

Sequencing Primer
(F):5'- GCAAGAGCTTCCCGAACTG -3'
(R):5'- TTAGGAGCAAGCTGACATGCCC -3'

Posted On

2014-08-25