Incidental Mutation 'R2030:Kcp'
ID221126
Institutional Source Beutler Lab
Gene Symbol Kcp
Ensembl Gene ENSMUSG00000059022
Gene Namekielin/chordin-like protein
SynonymsCrim2, KCP, LOC333088
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R2030 (G1)
Quality Score188
Status Validated
Chromosome6
Chromosomal Location29473162-29507952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29489072 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1072 (L1072F)
Ref Sequence ENSEMBL: ENSMUSP00000099135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]
Predicted Effect probably damaging
Transcript: ENSMUST00000078112
AA Change: L1072F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: L1072F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
Pfam:VWD 1214 1254 4.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091391
AA Change: L1071F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: L1071F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1082 6.53e-9 SMART
VWC 1089 1142 1.05e-3 SMART
VWC 1149 1206 2.93e-11 SMART
Pfam:VWD 1213 1253 4.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101614
AA Change: L1072F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: L1072F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 8e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
VWD 1201 1362 6.09e-50 SMART
C8 1404 1479 1.55e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158018
Predicted Effect probably damaging
Transcript: ENSMUST00000159479
AA Change: L342F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022
AA Change: L342F

DomainStartEndE-ValueType
VWC 1 51 4.56e-1 SMART
VWC 54 110 1.98e-8 SMART
VWC 113 169 1.35e-1 SMART
VWC 172 228 5.77e-10 SMART
VWC 231 286 1.21e-3 SMART
VWC 289 353 6.53e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159482
Predicted Effect probably benign
Transcript: ENSMUST00000161276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161655
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Kcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Kcp APN 6 29482657 missense probably benign
IGL01344:Kcp APN 6 29498951 splice site probably null
IGL01404:Kcp APN 6 29496639 missense probably damaging 0.99
IGL01735:Kcp APN 6 29498879 missense probably damaging 1.00
IGL01776:Kcp APN 6 29497908 missense probably damaging 1.00
IGL02092:Kcp APN 6 29489032 critical splice donor site probably null
IGL02252:Kcp APN 6 29504549 missense probably damaging 1.00
IGL02690:Kcp APN 6 29484999 unclassified probably benign
IGL02817:Kcp APN 6 29496969 missense probably damaging 0.97
IGL03074:Kcp APN 6 29496631 missense probably damaging 1.00
P0045:Kcp UTSW 6 29498348 missense probably damaging 1.00
R0219:Kcp UTSW 6 29495785 missense probably damaging 1.00
R0355:Kcp UTSW 6 29496927 missense possibly damaging 0.89
R0738:Kcp UTSW 6 29490439 missense probably benign 0.24
R1111:Kcp UTSW 6 29485423 missense probably benign
R1304:Kcp UTSW 6 29501292 unclassified probably benign
R1663:Kcp UTSW 6 29498965 missense possibly damaging 0.68
R1808:Kcp UTSW 6 29505655 missense probably benign 0.05
R1907:Kcp UTSW 6 29497835 unclassified probably benign
R2099:Kcp UTSW 6 29496165 nonsense probably null
R3411:Kcp UTSW 6 29482846 missense possibly damaging 0.68
R3982:Kcp UTSW 6 29484637 missense probably damaging 1.00
R3983:Kcp UTSW 6 29484637 missense probably damaging 1.00
R4223:Kcp UTSW 6 29482258 missense possibly damaging 0.55
R4377:Kcp UTSW 6 29493203 missense probably damaging 1.00
R4570:Kcp UTSW 6 29491848 nonsense probably null
R4624:Kcp UTSW 6 29482814 missense possibly damaging 0.94
R4694:Kcp UTSW 6 29493197 missense probably benign 0.29
R4750:Kcp UTSW 6 29484626 missense probably benign 0.03
R4968:Kcp UTSW 6 29497629 nonsense probably null
R5053:Kcp UTSW 6 29496958 missense probably benign 0.01
R5067:Kcp UTSW 6 29492108 missense probably benign 0.06
R5253:Kcp UTSW 6 29498520 unclassified probably benign
R5418:Kcp UTSW 6 29504284 nonsense probably null
R6020:Kcp UTSW 6 29502864 missense probably benign 0.03
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6088:Kcp UTSW 6 29502632 missense probably benign
R6178:Kcp UTSW 6 29482888 missense possibly damaging 0.68
R6285:Kcp UTSW 6 29502365 missense probably benign 0.21
R6310:Kcp UTSW 6 29493258 missense probably damaging 0.98
R6369:Kcp UTSW 6 29484694 missense probably damaging 1.00
R6860:Kcp UTSW 6 29505720 missense probably benign 0.19
R6949:Kcp UTSW 6 29484612 splice site probably null
R6962:Kcp UTSW 6 29482840 missense probably benign 0.08
R7006:Kcp UTSW 6 29499170 missense probably damaging 1.00
R7138:Kcp UTSW 6 29491862 nonsense probably null
R7141:Kcp UTSW 6 29487512 nonsense probably null
R7153:Kcp UTSW 6 29499015 missense probably damaging 1.00
R7162:Kcp UTSW 6 29497200 intron probably null
R7334:Kcp UTSW 6 29485512 missense probably damaging 1.00
R7565:Kcp UTSW 6 29499187 missense probably damaging 1.00
R7671:Kcp UTSW 6 29496517 missense probably benign 0.02
R7766:Kcp UTSW 6 29496847 missense probably damaging 0.98
R7781:Kcp UTSW 6 29497765 missense probably damaging 1.00
Z1176:Kcp UTSW 6 29485012 missense probably benign 0.23
Z1177:Kcp UTSW 6 29485525 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AACAAGCTTTGCCAACTTAAGC -3'
(R):5'- TCTCTGGATTAGGAGCAAGCTGAC -3'

Sequencing Primer
(F):5'- GCAAGAGCTTCCCGAACTG -3'
(R):5'- TTAGGAGCAAGCTGACATGCCC -3'
Posted On2014-08-25