Incidental Mutation 'R1972:Naip5'
ID221129
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene NameNLR family, apoptosis inhibitory protein 5
SynonymsBirc1e, Lgn1, Naip-rs3
MMRRC Submission 039985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1972 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100211739-100246323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100212770 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1350 (V1350A)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
Predicted Effect probably damaging
Transcript: ENSMUST00000049789
AA Change: V1350A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: V1350A

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (77/77)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,990,418 probably benign Het
Bbs2 A G 8: 94,081,177 probably benign Het
Bcl9 A C 3: 97,207,202 D1035E probably damaging Het
Bmpr2 A G 1: 59,813,603 E31G possibly damaging Het
Borcs5 A G 6: 134,710,174 D164G probably damaging Het
Cap2 A G 13: 46,637,899 R181G probably damaging Het
Ccdc113 A T 8: 95,538,246 H128L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chrm4 C T 2: 91,927,493 A82V probably benign Het
Cyp2d22 A T 15: 82,375,827 M52K probably benign Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dgka C T 10: 128,720,466 G717D probably damaging Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Eif2ak1 A G 5: 143,884,714 T283A probably benign Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Fcgbp A T 7: 28,094,192 Y1173F probably benign Het
Flt1 G A 5: 147,655,093 probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Gsdma2 T C 11: 98,650,918 V157A probably benign Het
Heatr4 T A 12: 83,955,020 I884F probably damaging Het
Il17ra A G 6: 120,482,216 E776G probably benign Het
Inpp5d T C 1: 87,676,314 S235P probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Isoc2a T A 7: 4,892,087 D171E probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kcnk12 T C 17: 87,797,132 D108G possibly damaging Het
Klra9 A T 6: 130,182,382 probably null Het
Lgmn A G 12: 102,395,821 probably benign Het
Morf4l1 A T 9: 90,095,214 probably benign Het
Mthfr T C 4: 148,051,927 I380T probably damaging Het
Mybpc1 T C 10: 88,551,542 I436V probably benign Het
Neil2 A T 14: 63,186,077 C36S possibly damaging Het
Nlrx1 A G 9: 44,253,456 V897A probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nop2 A G 6: 125,134,639 T112A probably benign Het
Nrap T A 19: 56,357,353 T608S probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Olfr1218 A T 2: 89,054,547 M293K probably benign Het
Olfr1475 T C 19: 13,479,694 N168S probably benign Het
Olfr209 A T 16: 59,362,113 V35D probably damaging Het
Olfr417 T C 1: 174,369,570 F218L probably benign Het
Olfr671 T C 7: 104,975,899 I33V possibly damaging Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Pde1a T C 2: 79,865,721 E358G probably damaging Het
Pdlim1 A T 19: 40,223,137 S237R probably damaging Het
Pithd1 T C 4: 135,987,029 D36G probably damaging Het
Ppp2r3a A G 9: 101,211,777 F449S probably benign Het
Prr11 G A 11: 87,098,754 R264C possibly damaging Het
Rbm43 A T 2: 51,925,536 H224Q probably benign Het
Rfx5 C T 3: 94,957,292 L250F probably damaging Het
Rgs22 T A 15: 36,103,836 I160L probably benign Het
Rorb T A 19: 18,952,203 Q393H probably damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Scaf8 T G 17: 3,169,371 S276R unknown Het
Scube2 A T 7: 109,809,214 N675K probably benign Het
Sec22c A T 9: 121,688,254 M126K possibly damaging Het
Serpinb11 T C 1: 107,369,480 F29L probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc18a2 A G 19: 59,274,653 D294G possibly damaging Het
Slc9c1 A G 16: 45,593,472 T988A possibly damaging Het
Smndc1 A C 19: 53,383,555 probably null Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spatc1 A T 15: 76,284,875 probably null Het
Stab2 A T 10: 86,960,316 C356S probably damaging Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tbc1d30 A T 10: 121,306,230 probably null Het
Tenm3 T C 8: 48,228,591 E2668G probably damaging Het
Tigar A G 6: 127,087,926 V253A possibly damaging Het
Tmc2 T A 2: 130,214,664 probably benign Het
Ttc26 C A 6: 38,410,803 N396K probably benign Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Vmn2r82 A G 10: 79,378,846 D221G probably damaging Het
Xkr5 C T 8: 18,941,981 V131M probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
Nuchal UTSW 13 100214663 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
R7886:Naip5 UTSW 13 100246181 missense probably benign 0.28
R7996:Naip5 UTSW 13 100221656 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100245898 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100222233 missense probably benign
R8319:Naip5 UTSW 13 100221659 missense probably benign 0.12
R8471:Naip5 UTSW 13 100221645 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100222235 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100212739 missense probably benign 0.00
R8500:Naip5 UTSW 13 100222712 missense probably damaging 0.98
R8712:Naip5 UTSW 13 100223096 missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100219830 missense probably benign
R8781:Naip5 UTSW 13 100219830 missense probably benign
R8788:Naip5 UTSW 13 100219830 missense probably benign
R8817:Naip5 UTSW 13 100212699 missense probably benign 0.01
R8833:Naip5 UTSW 13 100222934 missense probably damaging 0.97
R8835:Naip5 UTSW 13 100219830 missense probably benign
R8958:Naip5 UTSW 13 100217609 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCAGTAGTCTTCAGGAGCATCC -3'
(R):5'- CATACGTGTTTTGTTTTCAGCCAG -3'

Sequencing Primer
(F):5'- TCCTTTACTCCAGGATAACAGGAGAG -3'
(R):5'- GGCGGCAACCAGTGGAG -3'
Posted On2014-08-25