Incidental Mutation 'R2030:Nlrp12'
ID221138
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene NameNLR family, pyrin domain containing 12
SynonymsNalp12
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3218784-3249740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3228417 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 960 (H960L)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
Predicted Effect probably damaging
Transcript: ENSMUST00000108653
AA Change: H960L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: H960L

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Meta Mutation Damage Score 0.2603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3241433 missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3240442 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3241373 missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3219259 utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3240683 missense probably benign 0.03
R6957:Nlrp12 UTSW 7 3222486 missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3228388 critical splice donor site probably null
R7793:Nlrp12 UTSW 7 3245400 missense probably benign
R8257:Nlrp12 UTSW 7 3249332 missense probably damaging 1.00
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1176:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1177:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACCCTTGCCTTGGCCTTG -3'
(R):5'- AACAAAGTCAGCTTGGCCATC -3'

Sequencing Primer
(F):5'- AGCCATCAGTCCAATTGGTG -3'
(R):5'- AAGTCAGCTTGGCCATCCCTAC -3'
Posted On2014-08-25