Incidental Mutation 'R2030:Mrgprb1'
ID 221142
Institutional Source Beutler Lab
Gene Symbol Mrgprb1
Ensembl Gene ENSMUSG00000070547
Gene Name MAS-related GPR, member B1
Synonyms MrgB1
MMRRC Submission 040037-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R2030 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 48093861-48106090 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48097076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 279 (S279T)
Ref Sequence ENSEMBL: ENSMUSP00000091946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094384] [ENSMUST00000188095] [ENSMUST00000188918]
AlphaFold Q3UG61
Predicted Effect possibly damaging
Transcript: ENSMUST00000094384
AA Change: S279T

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091946
Gene: ENSMUSG00000070547
AA Change: S279T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 227 5.5e-11 PFAM
Pfam:7tm_1 59 290 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188095
Predicted Effect probably benign
Transcript: ENSMUST00000188918
SMART Domains Protein: ENSMUSP00000140432
Gene: ENSMUSG00000070547

DomainStartEndE-ValueType
SCOP:d1l9ha_ 23 84 3e-6 SMART
Meta Mutation Damage Score 0.6389 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp C T 13: 41,981,735 (GRCm39) V13I probably damaging Het
Ak2 A G 4: 128,902,013 (GRCm39) K229E probably benign Het
Atp13a4 A T 16: 29,241,502 (GRCm39) V741D probably damaging Het
Bdp1 A T 13: 100,197,697 (GRCm39) M896K probably benign Het
Ccser1 C T 6: 61,288,547 (GRCm39) R237C probably benign Het
Cdk7 A G 13: 100,859,182 (GRCm39) probably benign Het
CK137956 A G 4: 127,845,180 (GRCm39) S188P probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dbndd2 A G 2: 164,330,563 (GRCm39) D72G probably damaging Het
Disp3 A T 4: 148,344,423 (GRCm39) I493N probably damaging Het
Dnaaf10 A T 11: 17,179,832 (GRCm39) T278S probably benign Het
Epx T C 11: 87,755,650 (GRCm39) D678G probably damaging Het
Fbxw5 G T 2: 25,394,810 (GRCm39) V235L probably damaging Het
Fmo4 T A 1: 162,621,741 (GRCm39) D490V probably damaging Het
Fuca2 A G 10: 13,382,518 (GRCm39) Y268C probably damaging Het
Gm4787 C T 12: 81,425,544 (GRCm39) V205I probably damaging Het
Gpat3 G A 5: 101,045,687 (GRCm39) R437K probably benign Het
Herc2 A G 7: 55,834,121 (GRCm39) S3109G probably damaging Het
Hr G A 14: 70,808,888 (GRCm39) R1117H probably damaging Het
Htra4 T A 8: 25,523,593 (GRCm39) D324V probably damaging Het
Kcnd3 A G 3: 105,366,853 (GRCm39) Y241C probably damaging Het
Kcp G A 6: 29,489,071 (GRCm39) L1072F probably damaging Het
Lrrc52 T C 1: 167,294,028 (GRCm39) N86D probably benign Het
Mindy4 A G 6: 55,188,247 (GRCm39) T26A probably damaging Het
Mre11a A T 9: 14,707,101 (GRCm39) N117Y probably damaging Het
Myh13 T G 11: 67,241,064 (GRCm39) S814A probably benign Het
Ncapd2 A G 6: 125,153,678 (GRCm39) V679A possibly damaging Het
Nipbl A T 15: 8,379,771 (GRCm39) V1007D probably damaging Het
Nlrp12 T A 7: 3,277,049 (GRCm39) H960L probably damaging Het
Or3a1c T A 11: 74,046,769 (GRCm39) M263K possibly damaging Het
Or4a72 C T 2: 89,405,558 (GRCm39) V171I probably benign Het
Or7e169 A G 9: 19,757,709 (GRCm39) S69P probably benign Het
Pklr A G 3: 89,050,545 (GRCm39) Y402C probably damaging Het
Prdm2 T C 4: 142,859,334 (GRCm39) T1319A possibly damaging Het
Rif1 T A 2: 51,982,358 (GRCm39) V541E probably damaging Het
Ryk T A 9: 102,758,855 (GRCm39) I248N possibly damaging Het
Shisa2 A T 14: 59,867,134 (GRCm39) I129F probably damaging Het
Snap25 T G 2: 136,611,973 (GRCm39) probably benign Het
Snx31 G A 15: 36,525,848 (GRCm39) P284S probably benign Het
Spata31g1 C T 4: 42,974,131 (GRCm39) Q1155* probably null Het
Tas2r140 A G 6: 40,469,154 (GRCm39) K328R possibly damaging Het
Tas2r140 T C 6: 133,032,213 (GRCm39) T182A probably benign Het
Thumpd2 G A 17: 81,372,387 (GRCm39) R35C probably damaging Het
Tnxb A T 17: 34,937,443 (GRCm39) N3811Y probably damaging Het
Tpte A C 8: 22,835,901 (GRCm39) N428T probably damaging Het
Trpm6 A G 19: 18,831,629 (GRCm39) D1498G probably benign Het
Tsc2 C T 17: 24,842,444 (GRCm39) probably benign Het
Ttn C T 2: 76,703,277 (GRCm39) probably benign Het
Wdr24 A G 17: 26,045,017 (GRCm39) I251V probably benign Het
Zc3h6 T C 2: 128,848,006 (GRCm39) Y278H probably damaging Het
Zfat A G 15: 67,990,783 (GRCm39) probably null Het
Zfp442 A T 2: 150,250,042 (GRCm39) V620E possibly damaging Het
Zfp788 A G 7: 41,298,984 (GRCm39) H540R probably damaging Het
Other mutations in Mrgprb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Mrgprb1 APN 7 48,097,291 (GRCm39) missense probably damaging 0.99
IGL01141:Mrgprb1 APN 7 48,097,775 (GRCm39) missense probably benign 0.36
IGL01393:Mrgprb1 APN 7 48,097,754 (GRCm39) missense possibly damaging 0.48
IGL02430:Mrgprb1 APN 7 48,097,409 (GRCm39) missense possibly damaging 0.95
IGL02485:Mrgprb1 APN 7 48,097,465 (GRCm39) missense possibly damaging 0.88
R0026:Mrgprb1 UTSW 7 48,096,952 (GRCm39) missense possibly damaging 0.66
R0051:Mrgprb1 UTSW 7 48,096,962 (GRCm39) missense probably benign 0.01
R0789:Mrgprb1 UTSW 7 48,105,932 (GRCm39) splice site probably benign
R1223:Mrgprb1 UTSW 7 48,097,435 (GRCm39) missense possibly damaging 0.61
R1327:Mrgprb1 UTSW 7 48,097,177 (GRCm39) missense possibly damaging 0.87
R1456:Mrgprb1 UTSW 7 48,097,777 (GRCm39) missense probably damaging 0.98
R1561:Mrgprb1 UTSW 7 48,096,873 (GRCm39) splice site probably null
R1567:Mrgprb1 UTSW 7 48,097,201 (GRCm39) missense probably damaging 0.97
R2165:Mrgprb1 UTSW 7 48,097,070 (GRCm39) missense probably benign 0.00
R2885:Mrgprb1 UTSW 7 48,097,469 (GRCm39) missense probably damaging 1.00
R3108:Mrgprb1 UTSW 7 48,097,076 (GRCm39) missense possibly damaging 0.93
R3919:Mrgprb1 UTSW 7 48,097,829 (GRCm39) missense probably benign 0.03
R4021:Mrgprb1 UTSW 7 48,096,871 (GRCm39) missense possibly damaging 0.95
R4613:Mrgprb1 UTSW 7 48,097,456 (GRCm39) missense possibly damaging 0.91
R4809:Mrgprb1 UTSW 7 48,097,739 (GRCm39) missense possibly damaging 0.89
R5249:Mrgprb1 UTSW 7 48,097,225 (GRCm39) missense possibly damaging 0.91
R5425:Mrgprb1 UTSW 7 48,097,719 (GRCm39) missense possibly damaging 0.81
R5555:Mrgprb1 UTSW 7 48,097,523 (GRCm39) missense probably benign 0.06
R5595:Mrgprb1 UTSW 7 48,097,432 (GRCm39) missense probably damaging 0.99
R5982:Mrgprb1 UTSW 7 48,097,568 (GRCm39) missense probably benign 0.01
R6746:Mrgprb1 UTSW 7 48,097,645 (GRCm39) missense possibly damaging 0.82
R7066:Mrgprb1 UTSW 7 48,097,424 (GRCm39) missense probably benign 0.27
R7141:Mrgprb1 UTSW 7 48,097,435 (GRCm39) missense possibly damaging 0.61
R7633:Mrgprb1 UTSW 7 48,097,331 (GRCm39) missense probably benign 0.01
R8072:Mrgprb1 UTSW 7 48,097,895 (GRCm39) nonsense probably null
R8080:Mrgprb1 UTSW 7 48,096,658 (GRCm39) splice site probably null
R8112:Mrgprb1 UTSW 7 48,097,682 (GRCm39) missense probably damaging 0.97
R8493:Mrgprb1 UTSW 7 48,097,321 (GRCm39) missense probably damaging 0.99
R8817:Mrgprb1 UTSW 7 48,097,070 (GRCm39) missense probably benign 0.01
R9135:Mrgprb1 UTSW 7 48,097,046 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAAGCAGCTCTCAGTCCCTTC -3'
(R):5'- AGTCTGGCCTTGGTGCTTAC -3'

Sequencing Primer
(F):5'- GCTCTCAGTCCCTTCCAGACAG -3'
(R):5'- GGTGCTTACCATCTTCTGTGGC -3'
Posted On 2014-08-25