Incidental Mutation 'R2030:Htra4'
ID221148
Institutional Source Beutler Lab
Gene Symbol Htra4
Ensembl Gene ENSMUSG00000037406
Gene NameHtrA serine peptidase 4
Synonyms
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25024929-25038962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25033577 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 324 (D324V)
Ref Sequence ENSEMBL: ENSMUSP00000081044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084031]
Predicted Effect probably damaging
Transcript: ENSMUST00000084031
AA Change: D324V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081044
Gene: ENSMUSG00000037406
AA Change: D324V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IB 37 112 5.44e-7 SMART
KAZAL 109 158 7.92e-4 SMART
Pfam:Trypsin 182 368 5.5e-15 PFAM
Pfam:Trypsin_2 208 346 2.1e-34 PFAM
PDZ 385 470 5.34e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211059
Meta Mutation Damage Score 0.9677 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HtrA family of proteases. The encoded protein contains a putative signal peptide, an insulin growth factor binding domain, a Kazal protease inhibitor domain, a conserved trypsin domain and a PDZ domain. Based on studies on other related family members, this enzyme may function as a secreted oligomeric chaperone protease to degrade misfolded secretory proteins. Other human HtrA proteins have been implicated in arthritis, tumor suppression, unfolded stress response, apoptosis, and aging. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Htra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Htra4 APN 8 25033571 missense probably damaging 0.98
IGL01738:Htra4 APN 8 25025711 missense probably damaging 0.96
IGL02307:Htra4 APN 8 25033694 missense probably damaging 1.00
IGL03382:Htra4 APN 8 25029698 missense probably benign 0.17
R0057:Htra4 UTSW 8 25038808 missense probably benign
R0906:Htra4 UTSW 8 25037144 missense probably benign 0.00
R1075:Htra4 UTSW 8 25033596 missense probably benign 0.00
R1173:Htra4 UTSW 8 25030619 missense possibly damaging 0.92
R1180:Htra4 UTSW 8 25033719 missense probably damaging 1.00
R1854:Htra4 UTSW 8 25033581 missense probably damaging 1.00
R2225:Htra4 UTSW 8 25025720 missense probably benign 0.42
R4457:Htra4 UTSW 8 25038658 missense possibly damaging 0.90
R4626:Htra4 UTSW 8 25037114 missense probably benign 0.29
R4746:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R4797:Htra4 UTSW 8 25033659 missense probably damaging 1.00
R5369:Htra4 UTSW 8 25033569 missense possibly damaging 0.95
R6846:Htra4 UTSW 8 25030545 missense probably damaging 1.00
R6911:Htra4 UTSW 8 25025705 missense probably damaging 0.96
R7067:Htra4 UTSW 8 25033701 missense probably damaging 1.00
R7367:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R7446:Htra4 UTSW 8 25037165 missense probably benign 0.09
R7603:Htra4 UTSW 8 25025700 missense probably benign 0.03
R7725:Htra4 UTSW 8 25037153 missense possibly damaging 0.94
R7729:Htra4 UTSW 8 25037077 missense possibly damaging 0.63
R7893:Htra4 UTSW 8 25033679 missense possibly damaging 0.81
R7988:Htra4 UTSW 8 25030510 critical splice donor site probably null
R8140:Htra4 UTSW 8 25030558 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTGTATTGCAGCAGTGACCTC -3'
(R):5'- TGAGCTTCCAGTACTGCTGC -3'

Sequencing Primer
(F):5'- GCATGGTGCTGGTTATATCAAACAC -3'
(R):5'- TACTGCTGCTGGGCCGATC -3'
Posted On2014-08-25