Incidental Mutation 'R1972:Olfr1475'
ID221149
Institutional Source Beutler Lab
Gene Symbol Olfr1475
Ensembl Gene ENSMUSG00000096708
Gene Nameolfactory receptor 1475
SynonymsGA_x6K02T2RE5P-3812807-3811863, MOR202-36
MMRRC Submission 039985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1972 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13479252-13480196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13479694 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 168 (N168S)
Ref Sequence ENSEMBL: ENSMUSP00000079616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080801]
Predicted Effect probably benign
Transcript: ENSMUST00000080801
AA Change: N168S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079616
Gene: ENSMUSG00000096708
AA Change: N168S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.7e-9 PFAM
Pfam:7tm_1 39 288 1.6e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,990,418 probably benign Het
Bbs2 A G 8: 94,081,177 probably benign Het
Bcl9 A C 3: 97,207,202 D1035E probably damaging Het
Bmpr2 A G 1: 59,813,603 E31G possibly damaging Het
Borcs5 A G 6: 134,710,174 D164G probably damaging Het
Cap2 A G 13: 46,637,899 R181G probably damaging Het
Ccdc113 A T 8: 95,538,246 H128L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chrm4 C T 2: 91,927,493 A82V probably benign Het
Cyp2d22 A T 15: 82,375,827 M52K probably benign Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dgka C T 10: 128,720,466 G717D probably damaging Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Eif2ak1 A G 5: 143,884,714 T283A probably benign Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Fcgbp A T 7: 28,094,192 Y1173F probably benign Het
Flt1 G A 5: 147,655,093 probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Gsdma2 T C 11: 98,650,918 V157A probably benign Het
Heatr4 T A 12: 83,955,020 I884F probably damaging Het
Il17ra A G 6: 120,482,216 E776G probably benign Het
Inpp5d T C 1: 87,676,314 S235P probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Isoc2a T A 7: 4,892,087 D171E probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kcnk12 T C 17: 87,797,132 D108G possibly damaging Het
Klra9 A T 6: 130,182,382 probably null Het
Lgmn A G 12: 102,395,821 probably benign Het
Morf4l1 A T 9: 90,095,214 probably benign Het
Mthfr T C 4: 148,051,927 I380T probably damaging Het
Mybpc1 T C 10: 88,551,542 I436V probably benign Het
Naip5 A G 13: 100,212,770 V1350A probably damaging Het
Neil2 A T 14: 63,186,077 C36S possibly damaging Het
Nlrx1 A G 9: 44,253,456 V897A probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nop2 A G 6: 125,134,639 T112A probably benign Het
Nrap T A 19: 56,357,353 T608S probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Olfr1218 A T 2: 89,054,547 M293K probably benign Het
Olfr209 A T 16: 59,362,113 V35D probably damaging Het
Olfr417 T C 1: 174,369,570 F218L probably benign Het
Olfr671 T C 7: 104,975,899 I33V possibly damaging Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Pde1a T C 2: 79,865,721 E358G probably damaging Het
Pdlim1 A T 19: 40,223,137 S237R probably damaging Het
Pithd1 T C 4: 135,987,029 D36G probably damaging Het
Ppp2r3a A G 9: 101,211,777 F449S probably benign Het
Prr11 G A 11: 87,098,754 R264C possibly damaging Het
Rbm43 A T 2: 51,925,536 H224Q probably benign Het
Rfx5 C T 3: 94,957,292 L250F probably damaging Het
Rgs22 T A 15: 36,103,836 I160L probably benign Het
Rorb T A 19: 18,952,203 Q393H probably damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Scaf8 T G 17: 3,169,371 S276R unknown Het
Scube2 A T 7: 109,809,214 N675K probably benign Het
Sec22c A T 9: 121,688,254 M126K possibly damaging Het
Serpinb11 T C 1: 107,369,480 F29L probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc18a2 A G 19: 59,274,653 D294G possibly damaging Het
Slc9c1 A G 16: 45,593,472 T988A possibly damaging Het
Smndc1 A C 19: 53,383,555 probably null Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spatc1 A T 15: 76,284,875 probably null Het
Stab2 A T 10: 86,960,316 C356S probably damaging Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tbc1d30 A T 10: 121,306,230 probably null Het
Tenm3 T C 8: 48,228,591 E2668G probably damaging Het
Tigar A G 6: 127,087,926 V253A possibly damaging Het
Tmc2 T A 2: 130,214,664 probably benign Het
Ttc26 C A 6: 38,410,803 N396K probably benign Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Vmn2r82 A G 10: 79,378,846 D221G probably damaging Het
Xkr5 C T 8: 18,941,981 V131M probably damaging Het
Other mutations in Olfr1475
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr1475 APN 19 13479787 missense possibly damaging 0.81
IGL01604:Olfr1475 APN 19 13479248 unclassified probably benign
IGL01656:Olfr1475 APN 19 13480090 missense probably benign 0.08
IGL01802:Olfr1475 APN 19 13479365 missense probably benign 0.05
IGL01839:Olfr1475 APN 19 13479440 missense probably benign
IGL02255:Olfr1475 APN 19 13479985 missense probably damaging 1.00
IGL02706:Olfr1475 APN 19 13480098 nonsense probably null
IGL02723:Olfr1475 APN 19 13479335 missense probably damaging 1.00
IGL03143:Olfr1475 APN 19 13479471 missense probably damaging 1.00
IGL03174:Olfr1475 APN 19 13480069 missense probably benign 0.10
BB007:Olfr1475 UTSW 19 13479655 missense probably damaging 0.99
BB017:Olfr1475 UTSW 19 13479655 missense probably damaging 0.99
R0442:Olfr1475 UTSW 19 13480048 missense probably damaging 1.00
R0490:Olfr1475 UTSW 19 13479493 missense probably damaging 0.98
R0491:Olfr1475 UTSW 19 13479493 missense probably damaging 0.98
R1757:Olfr1475 UTSW 19 13479607 missense possibly damaging 0.67
R1843:Olfr1475 UTSW 19 13479931 missense probably benign 0.00
R2137:Olfr1475 UTSW 19 13479809 missense probably damaging 1.00
R3150:Olfr1475 UTSW 19 13479460 missense probably damaging 1.00
R3858:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3859:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3953:Olfr1475 UTSW 19 13479442 missense probably benign 0.43
R4611:Olfr1475 UTSW 19 13480012 missense probably damaging 0.96
R4934:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R5580:Olfr1475 UTSW 19 13479427 missense probably damaging 1.00
R6278:Olfr1475 UTSW 19 13479755 missense probably benign
R6444:Olfr1475 UTSW 19 13479430 missense possibly damaging 0.95
R6796:Olfr1475 UTSW 19 13479914 missense probably damaging 1.00
R6812:Olfr1475 UTSW 19 13479611 missense probably benign 0.03
R7608:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R7632:Olfr1475 UTSW 19 13479431 missense possibly damaging 0.79
R7930:Olfr1475 UTSW 19 13479655 missense probably damaging 0.99
R8008:Olfr1475 UTSW 19 13479806 missense probably benign 0.01
R8416:Olfr1475 UTSW 19 13479400 missense possibly damaging 0.95
R8551:Olfr1475 UTSW 19 13479745 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTGAACGCATTCTCAGGATAGC -3'
(R):5'- ATGTGCTGCCCAGATGTTC -3'

Sequencing Primer
(F):5'- TCTCAGGATAGCAATGAAAATAAGC -3'
(R):5'- GCTATTGAAAGTTTGATCCTTGCC -3'
Posted On2014-08-25