Incidental Mutation 'R2030:Mre11a'
ID221150
Institutional Source Beutler Lab
Gene Symbol Mre11a
Ensembl Gene ENSMUSG00000031928
Gene NameMRE11A homolog A, double strand break repair nuclease
Synonyms
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14784654-14837123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14795805 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 117 (N117Y)
Ref Sequence ENSEMBL: ENSMUSP00000116321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632] [ENSMUST00000147305]
Predicted Effect probably damaging
Transcript: ENSMUST00000034405
AA Change: N117Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: N117Y

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 6.3e-15 PFAM
Mre11_DNA_bind 294 462 1.72e-70 SMART
coiled coil region 487 519 N/A INTRINSIC
low complexity region 566 594 N/A INTRINSIC
low complexity region 683 699 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115632
AA Change: N117Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: N117Y

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 1.1e-31 PFAM
Mre11_DNA_bind 294 435 7.6e-49 SMART
coiled coil region 460 492 N/A INTRINSIC
low complexity region 539 567 N/A INTRINSIC
low complexity region 656 672 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136568
SMART Domains Protein: ENSMUSP00000121012
Gene: ENSMUSG00000031928

DomainStartEndE-ValueType
PDB:3T1I|D 1 107 1e-70 PDB
SCOP:d1ii7a_ 3 107 7e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147305
AA Change: N117Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116321
Gene: ENSMUSG00000031928
AA Change: N117Y

DomainStartEndE-ValueType
Pfam:Metallophos 13 199 1.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147676
SMART Domains Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928

DomainStartEndE-ValueType
PDB:3T1I|D 2 50 3e-26 PDB
Mre11_DNA_bind 62 170 1.81e-32 SMART
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Mre11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Mre11a APN 9 14825208 missense probably benign 0.28
IGL00429:Mre11a APN 9 14802813 missense probably damaging 1.00
IGL00922:Mre11a APN 9 14799588 missense probably damaging 1.00
IGL01095:Mre11a APN 9 14809824 missense probably benign
IGL01294:Mre11a APN 9 14830915 missense probably damaging 0.97
IGL01871:Mre11a APN 9 14811897 missense possibly damaging 0.95
IGL02194:Mre11a APN 9 14815209 missense possibly damaging 0.70
IGL02213:Mre11a APN 9 14811884 missense probably damaging 1.00
IGL02245:Mre11a APN 9 14815276 unclassified probably benign
IGL02749:Mre11a APN 9 14826591 missense possibly damaging 0.78
IGL02812:Mre11a APN 9 14790670 unclassified probably null
R0050:Mre11a UTSW 9 14830973 splice site probably benign
R0594:Mre11a UTSW 9 14815209 missense probably benign 0.00
R1241:Mre11a UTSW 9 14799639 missense probably damaging 1.00
R1905:Mre11a UTSW 9 14799627 missense probably benign 0.08
R2270:Mre11a UTSW 9 14815174 missense probably benign 0.00
R2511:Mre11a UTSW 9 14795769 critical splice acceptor site probably null
R2851:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2852:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2853:Mre11a UTSW 9 14826547 missense probably benign 0.00
R3765:Mre11a UTSW 9 14809847 missense probably benign 0.25
R4612:Mre11a UTSW 9 14802903 missense probably damaging 1.00
R5007:Mre11a UTSW 9 14809820 missense probably benign 0.10
R5343:Mre11a UTSW 9 14811834 missense probably damaging 0.98
R5679:Mre11a UTSW 9 14786919 missense probably damaging 0.99
R5834:Mre11a UTSW 9 14799657 missense probably benign 0.15
R5914:Mre11a UTSW 9 14811936 missense probably damaging 1.00
R5935:Mre11a UTSW 9 14786962 missense probably damaging 1.00
R6089:Mre11a UTSW 9 14819464 missense probably benign 0.02
R6393:Mre11a UTSW 9 14785509 start codon destroyed probably null 0.00
R6625:Mre11a UTSW 9 14805391 missense possibly damaging 0.52
R7248:Mre11a UTSW 9 14811913 missense possibly damaging 0.52
R7744:Mre11a UTSW 9 14809832 missense possibly damaging 0.94
R7999:Mre11a UTSW 9 14799669 nonsense probably null
R8179:Mre11a UTSW 9 14797066 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGTTTATTTCCAGCACTGAGC -3'
(R):5'- GCATGGCTCTCTCATGTAACAATTC -3'

Sequencing Primer
(F):5'- CACTGAGCTGGGGTTGTC -3'
(R):5'- GGTAGATGCATTGTACTGATA -3'
Posted On2014-08-25