Mutagenetix > Incidental Mutation

Incidental Mutation 'R1972:Pdlim1'

221153

Institutional Source

Beutler Lab

Gene Symbol

Pdlim1

Ensembl Gene

ENSMUSG00000055044

Gene Name

PDZ and LIM domain 1 (elfin)

Synonyms

CLP36, mClim1

MMRRC Submission

039985-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40221173-40271842 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 40223137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 237 (S237R)

Ref Sequence

ENSEMBL: ENSMUSP00000064545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068439]

AlphaFold

O70400

Predicted Effect

probably damaging
Transcript: ENSMUST00000068439
AA Change: S237R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064545
Gene: ENSMUSG00000055044
AA Change: S237R

Domain	Start	End	E-Value	Type
PDZ	12	85	3.23e-18	SMART
Pfam:DUF4749	136	234	4.6e-29	PFAM
LIM	257	308	2.31e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182813

Meta Mutation Damage Score

0.1350

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enigma protein family. The protein contains two protein interacting domains, a PDZ domain at the amino terminal end and one to three LIM domains at the carboxyl terminal. It is a cytoplasmic protein associated with the cytoskeleton. The protein may function as an adapter to bring other LIM-interacting proteins to the cytoskeleton. Pseudogenes associated with this gene are located on chromosomes 3, 14 and 17. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced platelet response to GPVI agonists and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adat1	A	G	8: 111,990,418		probably benign	Het
Bbs2	A	G	8: 94,081,177		probably benign	Het
Bcl9	A	C	3: 97,207,202	D1035E	probably damaging	Het
Bmpr2	A	G	1: 59,813,603	E31G	possibly damaging	Het
Borcs5	A	G	6: 134,710,174	D164G	probably damaging	Het
Cap2	A	G	13: 46,637,899	R181G	probably damaging	Het
Ccdc113	A	T	8: 95,538,246	H128L	probably benign	Het
Cdh7	G	A	1: 110,061,132	V255I	probably benign	Het
Chat	C	T	14: 32,424,191	V342I	probably benign	Het
Chrm4	C	T	2: 91,927,493	A82V	probably benign	Het
Cyp2d22	A	T	15: 82,375,827	M52K	probably benign	Het
Dennd2c	T	C	3: 103,131,698	V54A	probably benign	Het
Dgka	C	T	10: 128,720,466	G717D	probably damaging	Het
Dnah1	C	T	14: 31,265,391	W3550*	probably null	Het
Eif2ak1	A	G	5: 143,884,714	T283A	probably benign	Het
Fam189a1	A	T	7: 64,775,768	I192N	possibly damaging	Het
Fcgbp	A	T	7: 28,094,192	Y1173F	probably benign	Het
Flt1	G	A	5: 147,655,093		probably benign	Het
Gpr149	T	C	3: 62,530,795	K647R	probably benign	Het
Gsdma2	T	C	11: 98,650,918	V157A	probably benign	Het
Heatr4	T	A	12: 83,955,020	I884F	probably damaging	Het
Il17ra	A	G	6: 120,482,216	E776G	probably benign	Het
Inpp5d	T	C	1: 87,676,314	S235P	probably benign	Het
Iqgap3	T	A	3: 88,083,928		probably null	Het
Isoc2a	T	A	7: 4,892,087	D171E	probably damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Kcnk12	T	C	17: 87,797,132	D108G	possibly damaging	Het
Klra9	A	T	6: 130,182,382		probably null	Het
Lgmn	A	G	12: 102,395,821		probably benign	Het
Morf4l1	A	T	9: 90,095,214		probably benign	Het
Mthfr	T	C	4: 148,051,927	I380T	probably damaging	Het
Mybpc1	T	C	10: 88,551,542	I436V	probably benign	Het
Naip5	A	G	13: 100,212,770	V1350A	probably damaging	Het
Neil2	A	T	14: 63,186,077	C36S	possibly damaging	Het
Nlrx1	A	G	9: 44,253,456	V897A	probably benign	Het
Nod2	A	T	8: 88,652,873	M8L	probably damaging	Het
Nop2	A	G	6: 125,134,639	T112A	probably benign	Het
Nrap	T	A	19: 56,357,353	T608S	probably damaging	Het
Nuak2	A	T	1: 132,330,602	H257L	probably damaging	Het
Olfr1218	A	T	2: 89,054,547	M293K	probably benign	Het
Olfr1475	T	C	19: 13,479,694	N168S	probably benign	Het
Olfr209	A	T	16: 59,362,113	V35D	probably damaging	Het
Olfr417	T	C	1: 174,369,570	F218L	probably benign	Het
Olfr671	T	C	7: 104,975,899	I33V	possibly damaging	Het
Olfr693	T	C	7: 106,678,219	D89G	probably benign	Het
Olfr889	T	A	9: 38,116,567	M257K	possibly damaging	Het
Pde1a	T	C	2: 79,865,721	E358G	probably damaging	Het
Pithd1	T	C	4: 135,987,029	D36G	probably damaging	Het
Ppp2r3a	A	G	9: 101,211,777	F449S	probably benign	Het
Prr11	G	A	11: 87,098,754	R264C	possibly damaging	Het
Rbm43	A	T	2: 51,925,536	H224Q	probably benign	Het
Rfx5	C	T	3: 94,957,292	L250F	probably damaging	Het
Rgs22	T	A	15: 36,103,836	I160L	probably benign	Het
Rorb	T	A	19: 18,952,203	Q393H	probably damaging	Het
Rpl13a	T	A	7: 45,125,995	K368*	probably null	Het
Scaf8	T	G	17: 3,169,371	S276R	unknown	Het
Scube2	A	T	7: 109,809,214	N675K	probably benign	Het
Sec22c	A	T	9: 121,688,254	M126K	possibly damaging	Het
Serpinb11	T	C	1: 107,369,480	F29L	probably damaging	Het
Sis	A	G	3: 72,921,004	F1217S	probably damaging	Het
Slc18a2	A	G	19: 59,274,653	D294G	possibly damaging	Het
Slc9c1	A	G	16: 45,593,472	T988A	possibly damaging	Het
Smndc1	A	C	19: 53,383,555		probably null	Het
Sned1	G	A	1: 93,265,073	G361S	probably damaging	Het
Spatc1	A	T	15: 76,284,875		probably null	Het
Stab2	A	T	10: 86,960,316	C356S	probably damaging	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Tbc1d30	A	T	10: 121,306,230		probably null	Het
Tenm3	T	C	8: 48,228,591	E2668G	probably damaging	Het
Tigar	A	G	6: 127,087,926	V253A	possibly damaging	Het
Tmc2	T	A	2: 130,214,664		probably benign	Het
Ttc26	C	A	6: 38,410,803	N396K	probably benign	Het
Ugt1a10	A	T	1: 88,056,047	Y189F	probably damaging	Het
Vmn2r82	A	G	10: 79,378,846	D221G	probably damaging	Het
Xkr5	C	T	8: 18,941,981	V131M	probably damaging	Het

Other mutations in Pdlim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02027:Pdlim1	APN	19	40243466	missense	probably benign	0.00
IGL02253:Pdlim1	APN	19	40230530	missense	probably damaging	0.99
IGL02312:Pdlim1	APN	19	40223061	missense	probably benign	0.00
IGL02584:Pdlim1	APN	19	40243400	splice site	probably null
R0391:Pdlim1	UTSW	19	40243573	missense	probably damaging	0.99
R1554:Pdlim1	UTSW	19	40223072	missense	probably benign	0.19
R1751:Pdlim1	UTSW	19	40251904	splice site	probably benign
R2900:Pdlim1	UTSW	19	40223075	missense	probably damaging	1.00
R4709:Pdlim1	UTSW	19	40222736	missense	probably benign	0.26
R4803:Pdlim1	UTSW	19	40243448	missense	possibly damaging	0.94
R4818:Pdlim1	UTSW	19	40223136	missense	probably damaging	0.98
R5360:Pdlim1	UTSW	19	40230549	missense	probably damaging	0.99
R5833:Pdlim1	UTSW	19	40230545	missense	probably damaging	1.00
R6547:Pdlim1	UTSW	19	40223120	missense	probably damaging	0.97
R7699:Pdlim1	UTSW	19	40249658	missense	probably damaging	0.99
R7700:Pdlim1	UTSW	19	40249658	missense	probably damaging	0.99
R7756:Pdlim1	UTSW	19	40243542	missense	probably benign	0.00
R7758:Pdlim1	UTSW	19	40243542	missense	probably benign	0.00
R7914:Pdlim1	UTSW	19	40252001	missense	probably damaging	0.98
R8201:Pdlim1	UTSW	19	40230514	missense	probably benign
R8331:Pdlim1	UTSW	19	40230551	missense	possibly damaging	0.70
R9698:Pdlim1	UTSW	19	40230515	missense	probably benign	0.01
R9733:Pdlim1	UTSW	19	40230596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGACTCGTCATTCTAAAAGCC -3'
(R):5'- CTTGCCCAGTCTTGCAGATC -3'

Sequencing Primer
(F):5'- CGTCATTCTAAAAGCCTCTATCATG -3'
(R):5'- CAGTCTTGCAGATCCTGATAGCAG -3'

Posted On

2014-08-25