Mutagenetix > Incidental Mutation

Incidental Mutation 'R2030:Gm4787'

221165

Institutional Source

Beutler Lab

Gene Symbol

Gm4787

Ensembl Gene

ENSMUSG00000072974

Gene Name

predicted gene 4787

Synonyms

MMRRC Submission

040037-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R2030 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81376991-81379464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 81378770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 205 (V205I)

Ref Sequence

ENSEMBL: ENSMUSP00000077390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]

AlphaFold

B2RUD9

Predicted Effect

probably damaging
Transcript: ENSMUST00000062182
AA Change: V205I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: V205I

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	46	163	1.5e-19	PFAM
Pfam:Reprolysin	213	406	4.6e-18	PFAM
DISIN	425	500	2e-33	SMART
ACR	501	644	2.83e-53	SMART
transmembrane domain	714	736	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110340

SMART Domains

Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	74	6.6e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164386

SMART Domains

Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

Domain	Start	End	E-Value	Type
PDZ	21	100	6.16e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166723

SMART Domains

Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	73	6.9e-16	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (54/54)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	C	T	4: 42,974,131	Q1155*	probably null	Het
Adtrp	C	T	13: 41,828,259	V13I	probably damaging	Het
Ak2	A	G	4: 129,008,220	K229E	probably benign	Het
Atp13a4	A	T	16: 29,422,684	V741D	probably damaging	Het
Bdp1	A	T	13: 100,061,189	M896K	probably benign	Het
Ccser1	C	T	6: 61,311,563	R237C	probably benign	Het
Cdk7	A	G	13: 100,722,674		probably benign	Het
CK137956	A	G	4: 127,951,387	S188P	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dbndd2	A	G	2: 164,488,643	D72G	probably damaging	Het
Disp3	A	T	4: 148,259,966	I493N	probably damaging	Het
Epx	T	C	11: 87,864,824	D678G	probably damaging	Het
Fbxw5	G	T	2: 25,504,798	V235L	probably damaging	Het
Fmo4	T	A	1: 162,794,172	D490V	probably damaging	Het
Fuca2	A	G	10: 13,506,774	Y268C	probably damaging	Het
Gpat3	G	A	5: 100,897,821	R437K	probably benign	Het
Herc2	A	G	7: 56,184,373	S3109G	probably damaging	Het
Hr	G	A	14: 70,571,448	R1117H	probably damaging	Het
Htra4	T	A	8: 25,033,577	D324V	probably damaging	Het
Kcnd3	A	G	3: 105,459,537	Y241C	probably damaging	Het
Kcp	G	A	6: 29,489,072	L1072F	probably damaging	Het
Lrrc52	T	C	1: 167,466,459	N86D	probably benign	Het
Mindy4	A	G	6: 55,211,262	T26A	probably damaging	Het
Mre11a	A	T	9: 14,795,805	N117Y	probably damaging	Het
Mrgprb1	A	T	7: 48,447,328	S279T	possibly damaging	Het
Myh13	T	G	11: 67,350,238	S814A	probably benign	Het
Ncapd2	A	G	6: 125,176,715	V679A	possibly damaging	Het
Nipbl	A	T	15: 8,350,287	V1007D	probably damaging	Het
Nlrp12	T	A	7: 3,228,417	H960L	probably damaging	Het
Olfr1245	C	T	2: 89,575,214	V171I	probably benign	Het
Olfr402	T	A	11: 74,155,943	M263K	possibly damaging	Het
Olfr860	A	G	9: 19,846,413	S69P	probably benign	Het
Pklr	A	G	3: 89,143,238	Y402C	probably damaging	Het
Prdm2	T	C	4: 143,132,764	T1319A	possibly damaging	Het
Rif1	T	A	2: 52,092,346	V541E	probably damaging	Het
Ryk	T	A	9: 102,881,656	I248N	possibly damaging	Het
Shisa2	A	T	14: 59,629,685	I129F	probably damaging	Het
Snap25	T	G	2: 136,770,053		probably benign	Het
Snx31	G	A	15: 36,525,702	P284S	probably benign	Het
Tas2r137	A	G	6: 40,492,220	K328R	possibly damaging	Het
Tas2r140	T	C	6: 133,055,250	T182A	probably benign	Het
Thumpd2	G	A	17: 81,064,958	R35C	probably damaging	Het
Tnxb	A	T	17: 34,718,469	N3811Y	probably damaging	Het
Tpte	A	C	8: 22,345,885	N428T	probably damaging	Het
Trpm6	A	G	19: 18,854,265	D1498G	probably benign	Het
Tsc2	C	T	17: 24,623,470		probably benign	Het
Ttn	C	T	2: 76,872,933		probably benign	Het
Wdr24	A	G	17: 25,826,043	I251V	probably benign	Het
Wdr92	A	T	11: 17,229,832	T278S	probably benign	Het
Zc3h6	T	C	2: 129,006,086	Y278H	probably damaging	Het
Zfat	A	G	15: 68,118,934		probably null	Het
Zfp442	A	T	2: 150,408,122	V620E	possibly damaging	Het
Zfp788	A	G	7: 41,649,560	H540R	probably damaging	Het

Other mutations in Gm4787

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01719:Gm4787	APN	12	81377174	missense	possibly damaging	0.50
IGL01916:Gm4787	APN	12	81377444	missense	probably benign	0.36
IGL02193:Gm4787	APN	12	81378528	missense	probably benign	0.02
IGL02623:Gm4787	APN	12	81378728	missense	probably damaging	1.00
IGL02681:Gm4787	APN	12	81378769	missense	possibly damaging	0.88
IGL03257:Gm4787	APN	12	81378052	missense	probably damaging	1.00
IGL03410:Gm4787	APN	12	81379174	missense	probably damaging	1.00
F5770:Gm4787	UTSW	12	81377567	nonsense	probably null
PIT4362001:Gm4787	UTSW	12	81377175	missense	probably benign
R0070:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R0128:Gm4787	UTSW	12	81377747	nonsense	probably null
R0220:Gm4787	UTSW	12	81378648	missense	probably damaging	0.98
R0304:Gm4787	UTSW	12	81378934	missense	probably damaging	1.00
R0513:Gm4787	UTSW	12	81378312	missense	probably benign	0.03
R1761:Gm4787	UTSW	12	81377176	missense	probably benign	0.02
R1809:Gm4787	UTSW	12	81378529	missense	possibly damaging	0.91
R1853:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R1854:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R2063:Gm4787	UTSW	12	81378920	missense	probably benign	0.39
R2112:Gm4787	UTSW	12	81377833	missense	probably damaging	1.00
R2140:Gm4787	UTSW	12	81378562	missense	probably benign	0.03
R2151:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2152:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2342:Gm4787	UTSW	12	81378758	missense	possibly damaging	0.91
R2504:Gm4787	UTSW	12	81379137	missense	possibly damaging	0.93
R4038:Gm4787	UTSW	12	81378358	missense	probably damaging	1.00
R4604:Gm4787	UTSW	12	81379213	missense	probably benign	0.17
R4748:Gm4787	UTSW	12	81378056	missense	probably damaging	1.00
R4750:Gm4787	UTSW	12	81378367	missense	possibly damaging	0.95
R4928:Gm4787	UTSW	12	81378838	missense	probably benign	0.03
R4960:Gm4787	UTSW	12	81379316	missense	probably damaging	0.99
R4974:Gm4787	UTSW	12	81377629	missense	probably damaging	0.99
R5028:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5029:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5031:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5098:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5099:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5100:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5101:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5135:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5152:Gm4787	UTSW	12	81378677	missense	probably benign	0.02
R5180:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5220:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5257:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5258:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5297:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5324:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5325:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5355:Gm4787	UTSW	12	81377465	nonsense	probably null
R5364:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5396:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5397:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5398:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5514:Gm4787	UTSW	12	81378328	missense	possibly damaging	0.90
R5634:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5666:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5670:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5787:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5788:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R6354:Gm4787	UTSW	12	81377981	missense	probably damaging	1.00
R6932:Gm4787	UTSW	12	81379200	missense	probably benign	0.04
R7120:Gm4787	UTSW	12	81378486	missense	probably benign	0.00
R7237:Gm4787	UTSW	12	81377668	missense	probably damaging	0.99
R7937:Gm4787	UTSW	12	81377905	missense	probably benign	0.01
R8022:Gm4787	UTSW	12	81377720	missense	possibly damaging	0.94
R8140:Gm4787	UTSW	12	81378151	missense	probably benign	0.00
R8314:Gm4787	UTSW	12	81379135	missense	probably damaging	1.00
R8480:Gm4787	UTSW	12	81377506	missense	probably damaging	1.00
R8498:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R8515:Gm4787	UTSW	12	81377269	missense	probably benign	0.00
R9103:Gm4787	UTSW	12	81378715	missense	probably benign	0.06
R9457:Gm4787	UTSW	12	81379246	missense	probably damaging	1.00
R9557:Gm4787	UTSW	12	81379300	nonsense	probably null
V7580:Gm4787	UTSW	12	81377567	nonsense	probably null
V7581:Gm4787	UTSW	12	81377567	nonsense	probably null
V7582:Gm4787	UTSW	12	81377567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTGTCATTCCAAATACACGCAG -3'
(R):5'- CTGGAGGTCTGAAAGGCATG -3'

Sequencing Primer
(F):5'- GCACGCGCGAACACAAAC -3'
(R):5'- GCATGATACAGGTAGATGACTTCAC -3'

Posted On

2014-08-25