Mutagenetix > Incidental Mutation

Incidental Mutation 'R1973:Zdbf2'

221166

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

039986-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R1973 (G1)

Quality Score

167

Status

Not validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 63309701 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 2413 (P2413Q)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

unknown
Transcript: ENSMUST00000029025
AA Change: P2413Q

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: P2413Q

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000114132
AA Change: P2413Q

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: P2413Q

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	A	C	5: 8,812,746	I143L	probably benign	Het
Acp7	T	A	7: 28,607,989	D481V	probably damaging	Het
AI597479	T	A	1: 43,111,126	I132K	probably benign	Het
Anxa13	T	C	15: 58,356,181		noncoding transcript	Het
Brca1	A	T	11: 101,526,403	C302S	probably benign	Het
Brd8	T	A	18: 34,608,013	D420V	probably damaging	Het
Cacna1g	A	T	11: 94,459,777	V414E	possibly damaging	Het
Ccdc142	T	A	6: 83,102,563	C294S	probably benign	Het
Cdh7	G	A	1: 110,061,132	V255I	probably benign	Het
Chat	C	T	14: 32,424,191	V342I	probably benign	Het
Chd6	A	G	2: 160,966,387	S1636P	probably damaging	Het
Clec4a1	A	G	6: 122,924,834		probably null	Het
Col6a3	A	T	1: 90,804,175	I1452N	probably damaging	Het
Dennd2c	T	C	3: 103,131,698	V54A	probably benign	Het
Dnah1	C	T	14: 31,265,391	W3550*	probably null	Het
Dscr3	T	C	16: 94,501,546	N267S	probably damaging	Het
Efl1	T	C	7: 82,762,877	S825P	probably damaging	Het
Fam189a1	A	T	7: 64,775,768	I192N	possibly damaging	Het
Faxc	G	A	4: 21,993,405	E350K	probably benign	Het
Frem2	T	A	3: 53,652,232	Y1618F	probably benign	Het
Fubp3	A	G	2: 31,603,286	T6A	probably benign	Het
Gm5814	A	T	17: 47,410,549	M63L	probably benign	Het
Gpr149	T	C	3: 62,530,795	K647R	probably benign	Het
Iqgap3	T	A	3: 88,083,928		probably null	Het
Kcnh3	T	C	15: 99,229,400	V359A	probably damaging	Het
Kit	G	A	5: 75,615,442	A295T	probably damaging	Het
Krt77	G	T	15: 101,861,244	A397E	probably damaging	Het
Mis18bp1	G	C	12: 65,149,076	S638*	probably null	Het
Neurl4	C	T	11: 69,909,292	P1091S	probably benign	Het
Nod2	A	T	8: 88,652,873	M8L	probably damaging	Het
Nos1	A	G	5: 117,936,426	T1046A	possibly damaging	Het
Nsfl1c	G	T	2: 151,505,414	S202I	probably damaging	Het
Nuak2	A	T	1: 132,330,602	H257L	probably damaging	Het
Nwd1	T	C	8: 72,704,962	V1195A	possibly damaging	Het
Olfr243	T	A	7: 103,716,597	M1K	probably null	Het
Olfr370	T	C	8: 83,541,792	V216A	probably benign	Het
Olfr693	T	C	7: 106,678,219	D89G	probably benign	Het
Olfr889	T	A	9: 38,116,567	M257K	possibly damaging	Het
Olfr919	A	G	9: 38,697,868	V170A	probably damaging	Het
Pclo	G	T	5: 14,676,059		probably null	Het
Pnpla7	A	G	2: 25,016,617	D664G	probably damaging	Het
Prl8a1	G	A	13: 27,576,934	T105I	probably benign	Het
Ptger1	C	A	8: 83,669,454	T380K	probably benign	Het
Ptk7	G	A	17: 46,586,807	Q282*	probably null	Het
Ptpn18	G	T	1: 34,463,109	D45Y	probably damaging	Het
Rab11fip3	T	C	17: 26,024,391	D589G	probably damaging	Het
Rara	A	G	11: 98,971,670	N299S	possibly damaging	Het
Rpl13a	T	A	7: 45,125,995	K368*	probably null	Het
Rslcan18	T	C	13: 67,108,023		probably benign	Het
Rtel1	A	G	2: 181,351,626	Y731C	probably benign	Het
Sec16a	A	T	2: 26,426,489	S1666R	probably damaging	Het
Sis	A	G	3: 72,921,004	F1217S	probably damaging	Het
Slc10a7	T	A	8: 78,697,333		probably null	Het
Slc22a7	A	G	17: 46,437,090	V214A	probably damaging	Het
Slc26a8	T	C	17: 28,663,605	I249V	probably benign	Het
Slc38a4	T	C	15: 96,999,597	K446E	probably benign	Het
Sned1	G	A	1: 93,265,073	G361S	probably damaging	Het
Spef2	T	G	15: 9,663,066	*876C	probably null	Het
Spink11	A	G	18: 44,196,138	C14R	unknown	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Tnfaip3	T	C	10: 19,004,504	N605S	probably damaging	Het
Trpc1	A	G	9: 95,723,255	M283T	probably benign	Het
Ttn	A	G	2: 76,714,362	S32799P	probably damaging	Het
Ttn	A	G	2: 76,720,099	I31613T	probably damaging	Het
Ugt1a10	A	T	1: 88,056,047	Y189F	probably damaging	Het
Usp32	G	T	11: 85,103,931	L52I	probably benign	Het
Usp33	A	G	3: 152,360,286	T68A	possibly damaging	Het
Vmn1r7	A	G	6: 57,025,026	F83S	probably benign	Het
Vmn2r5	C	T	3: 64,504,221	E309K	probably damaging	Het
Wdr43	A	G	17: 71,640,240	N364D	probably benign	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAGCACTAGCGCTCAAGCTC -3'
(R):5'- GAACTCAAGCTTCTCAGGTCATATTC -3'

Sequencing Primer
(F):5'- CCACGGGCTCTGTGCTC -3'
(R):5'- CAGGTCATATTCTCTCACTGGAAG -3'

Posted On

2014-08-25