Incidental Mutation 'R2030:Cdk7'
ID221171
Institutional Source Beutler Lab
Gene Symbol Cdk7
Ensembl Gene ENSMUSG00000069089
Gene Namecyclin-dependent kinase 7
SynonymsCdkn7, Crk4, CRK4 PK (CDC2-related-kinase-4 protein kinase)
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100702631-100730939 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 100722674 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091299] [ENSMUST00000225990]
Predicted Effect probably benign
Transcript: ENSMUST00000091299
SMART Domains Protein: ENSMUSP00000088845
Gene: ENSMUSG00000069089

DomainStartEndE-ValueType
S_TKc 12 295 7.59e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225578
Predicted Effect probably benign
Transcript: ENSMUST00000225990
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This protein forms a trimeric complex with cyclin H and MAT1, which functions as a Cdk-activating kinase (CAK). It is an essential component of the transcription factor TFIIH, that is involved in transcription initiation and DNA repair. This protein is thought to serve as a direct link between the regulation of transcription and the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null allele exhibit abnormal trophoblast layer morphology, abnormal inner cell mass apoptosis, and complete embryonic lethality during peri-implantation stages. Homoyzgous null MEFs display absent fibroblast proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Cdk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0055:Cdk7 UTSW 13 100719304 nonsense probably null
R0208:Cdk7 UTSW 13 100706514 missense probably benign
R0361:Cdk7 UTSW 13 100711554 nonsense probably null
R4994:Cdk7 UTSW 13 100717595 missense probably damaging 1.00
R5121:Cdk7 UTSW 13 100717684 critical splice acceptor site probably null
R5252:Cdk7 UTSW 13 100730460 nonsense probably null
R5527:Cdk7 UTSW 13 100730472 missense probably damaging 1.00
R7008:Cdk7 UTSW 13 100717621 missense probably damaging 0.99
R8100:Cdk7 UTSW 13 100706417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAACAGGCCAGCCATTACCG -3'
(R):5'- TGCACCTCCATGTCAGTCT -3'

Sequencing Primer
(F):5'- ATTACCGCTGAGCATGGCTG -3'
(R):5'- ATCCACGGTCAGAAGTTGTC -3'
Posted On2014-08-25