Incidental Mutation 'R2030:Tsc2'
ID221185
Institutional Source Beutler Lab
Gene Symbol Tsc2
Ensembl Gene ENSMUSG00000002496
Gene Nametuberous sclerosis 2
Synonymstuberin, Nafld
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24595816-24632630 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 24623470 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000228412]
Predicted Effect probably benign
Transcript: ENSMUST00000097373
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226284
Predicted Effect probably benign
Transcript: ENSMUST00000226398
Predicted Effect probably benign
Transcript: ENSMUST00000227607
Predicted Effect probably benign
Transcript: ENSMUST00000227745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227754
Predicted Effect probably benign
Transcript: ENSMUST00000228412
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Tsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Tsc2 APN 17 24608107 missense probably damaging 1.00
IGL00985:Tsc2 APN 17 24597131 missense probably damaging 1.00
IGL01386:Tsc2 APN 17 24613285 missense probably damaging 1.00
IGL01468:Tsc2 APN 17 24621097 missense possibly damaging 0.90
IGL01530:Tsc2 APN 17 24622662 missense possibly damaging 0.76
IGL02390:Tsc2 APN 17 24600453 missense probably damaging 1.00
IGL02398:Tsc2 APN 17 24621729 missense probably damaging 1.00
IGL02741:Tsc2 APN 17 24629969 missense probably damaging 1.00
IGL03191:Tsc2 APN 17 24628054 missense probably damaging 1.00
IGL03372:Tsc2 APN 17 24619470 missense probably damaging 1.00
IGL03412:Tsc2 APN 17 24597068 missense probably damaging 0.98
Twitch UTSW 17 24596742 unclassified probably null
PIT4515001:Tsc2 UTSW 17 24621147 missense probably benign 0.15
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0138:Tsc2 UTSW 17 24599626 missense possibly damaging 0.65
R0540:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0570:Tsc2 UTSW 17 24626727 missense probably damaging 1.00
R0607:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0826:Tsc2 UTSW 17 24596958 missense probably benign 0.04
R1430:Tsc2 UTSW 17 24599023 critical splice donor site probably null
R1440:Tsc2 UTSW 17 24614392 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1541:Tsc2 UTSW 17 24631976 missense probably damaging 1.00
R1717:Tsc2 UTSW 17 24597068 missense probably damaging 0.98
R1799:Tsc2 UTSW 17 24604408 missense probably benign
R2147:Tsc2 UTSW 17 24621142 missense possibly damaging 0.62
R2888:Tsc2 UTSW 17 24631995 critical splice donor site probably null
R3609:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3610:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3811:Tsc2 UTSW 17 24629037 missense probably benign 0.09
R3895:Tsc2 UTSW 17 24599812 missense probably damaging 1.00
R3962:Tsc2 UTSW 17 24621166 splice site probably benign
R3971:Tsc2 UTSW 17 24623588 missense probably damaging 1.00
R4018:Tsc2 UTSW 17 24625281 missense probably damaging 0.99
R4184:Tsc2 UTSW 17 24632016 missense probably benign 0.43
R4435:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4437:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4474:Tsc2 UTSW 17 24597264 missense probably damaging 0.98
R4703:Tsc2 UTSW 17 24604909 missense probably benign 0.13
R4731:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4732:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4733:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4817:Tsc2 UTSW 17 24596742 unclassified probably null
R4890:Tsc2 UTSW 17 24600035 missense probably damaging 1.00
R4922:Tsc2 UTSW 17 24600369 missense probably benign 0.22
R5119:Tsc2 UTSW 17 24603280 missense probably benign 0.00
R5393:Tsc2 UTSW 17 24600396 missense possibly damaging 0.89
R5785:Tsc2 UTSW 17 24599887 unclassified probably null
R5838:Tsc2 UTSW 17 24613216 missense probably benign 0.01
R5857:Tsc2 UTSW 17 24600007 missense probably damaging 0.99
R5911:Tsc2 UTSW 17 24600387 missense possibly damaging 0.63
R5988:Tsc2 UTSW 17 24620766 missense probably damaging 1.00
R6275:Tsc2 UTSW 17 24600420 missense probably benign 0.00
R6290:Tsc2 UTSW 17 24596910 missense probably benign 0.04
R6371:Tsc2 UTSW 17 24626714 missense probably benign 0.00
R6467:Tsc2 UTSW 17 24609127 missense probably benign 0.04
R6577:Tsc2 UTSW 17 24610499 missense probably damaging 1.00
R6728:Tsc2 UTSW 17 24621124 missense probably damaging 1.00
R6918:Tsc2 UTSW 17 24613229 missense probably damaging 1.00
R6995:Tsc2 UTSW 17 24628054 missense probably damaging 1.00
R7026:Tsc2 UTSW 17 24626739 missense probably damaging 0.99
R7136:Tsc2 UTSW 17 24613280 missense probably benign 0.00
R7236:Tsc2 UTSW 17 24623594 missense possibly damaging 0.82
R7243:Tsc2 UTSW 17 24599630 missense probably benign 0.02
R7249:Tsc2 UTSW 17 24607755 missense probably damaging 1.00
R7450:Tsc2 UTSW 17 24600031 missense probably damaging 1.00
R7522:Tsc2 UTSW 17 24630965 missense probably damaging 1.00
R7529:Tsc2 UTSW 17 24597948 missense probably damaging 0.98
R7637:Tsc2 UTSW 17 24607492 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGCTATCCTAGGGGCAACAC -3'
(R):5'- GAGGACTCTGCTCACATCTG -3'

Sequencing Primer
(F):5'- TACCTCAGCACTGGTGGG -3'
(R):5'- ACATCTGTCTTTCTGGGGAAC -3'
Posted On2014-08-25