Incidental Mutation 'R2031:Mrc1'
ID 221203
Institutional Source Beutler Lab
Gene Symbol Mrc1
Ensembl Gene ENSMUSG00000026712
Gene Name mannose receptor, C type 1
Synonyms CD206, MR
MMRRC Submission 040038-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R2031 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 14234225-14336834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14326584 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1161 (T1161S)
Ref Sequence ENSEMBL: ENSMUSP00000028045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028045]
AlphaFold Q61830
PDB Structure CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028045
AA Change: T1161S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: T1161S

DomainStartEndE-ValueType
RICIN 22 142 8.09e-18 SMART
FN2 161 209 1.83e-27 SMART
CLECT 216 341 8.87e-26 SMART
CLECT 362 487 3.51e-38 SMART
CLECT 504 626 8.2e-30 SMART
CLECT 646 778 2.34e-34 SMART
CLECT 800 923 2.17e-29 SMART
low complexity region 935 941 N/A INTRINSIC
CLECT 944 1079 3.35e-35 SMART
CLECT 1094 1212 4.11e-21 SMART
CLECT 1229 1355 3.63e-31 SMART
transmembrane domain 1388 1410 N/A INTRINSIC
Meta Mutation Damage Score 0.2114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,639,118 (GRCm39) N642K possibly damaging Het
Akap11 T A 14: 78,747,477 (GRCm39) I1637L possibly damaging Het
Aoc1l1 T C 6: 48,952,789 (GRCm39) V238A probably damaging Het
Arhgap28 G T 17: 68,203,111 (GRCm39) T114N probably damaging Het
Arid5b A G 10: 68,114,518 (GRCm39) probably null Het
Atp10a T A 7: 58,477,678 (GRCm39) C1292* probably null Het
Casp4 A G 9: 5,321,401 (GRCm39) S51G probably benign Het
Cast T C 13: 74,946,771 (GRCm39) probably null Het
Ccdc87 T C 19: 4,891,715 (GRCm39) F736L probably damaging Het
Cdon T C 9: 35,415,370 (GRCm39) S1203P probably damaging Het
Cep290 G A 10: 100,348,262 (GRCm39) probably null Het
Cep85 A G 4: 133,859,761 (GRCm39) V634A probably benign Het
Cpeb3 C T 19: 37,022,079 (GRCm39) R589H probably damaging Het
Crebrf T G 17: 26,961,895 (GRCm39) S331A probably damaging Het
Cul5 A G 9: 53,578,480 (GRCm39) V36A probably benign Het
Dock2 T A 11: 34,618,297 (GRCm39) probably benign Het
Dstyk G A 1: 132,380,929 (GRCm39) A475T probably damaging Het
Enpp6 C A 8: 47,506,649 (GRCm39) P151Q probably damaging Het
Fan1 A G 7: 64,004,172 (GRCm39) Y765H probably damaging Het
Hsfy2 A T 1: 56,675,476 (GRCm39) S354T probably benign Het
Ifi204 A C 1: 173,580,343 (GRCm39) F389C probably damaging Het
Ikbip T C 10: 90,932,474 (GRCm39) Y373H probably benign Het
Kbtbd11 C A 8: 15,078,021 (GRCm39) P207T possibly damaging Het
Krt73 A C 15: 101,707,199 (GRCm39) probably benign Het
Mfsd6 T A 1: 52,748,013 (GRCm39) Q284L probably benign Het
Mmp1b T A 9: 7,368,607 (GRCm39) D415V possibly damaging Het
Ms4a18 A G 19: 10,991,014 (GRCm39) S27P probably benign Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Mycbp2 G T 14: 103,426,028 (GRCm39) R2366S probably damaging Het
Nfkbia A G 12: 55,537,937 (GRCm39) L172P probably damaging Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Or1d2 A G 11: 74,255,777 (GRCm39) Y94C probably damaging Het
Or2ag15 A G 7: 106,341,105 (GRCm39) F12S probably damaging Het
Or4c107 A G 2: 88,789,643 (GRCm39) T278A probably benign Het
Or51f1e A G 7: 102,747,371 (GRCm39) Y141C probably damaging Het
Or5an10 A T 19: 12,275,740 (GRCm39) V252D probably damaging Het
Or5b112 T C 19: 13,319,770 (GRCm39) L216S probably benign Het
Parvb A T 15: 84,167,036 (GRCm39) Y117F probably benign Het
Plch2 A G 4: 155,127,484 (GRCm39) probably benign Het
Plxnb2 A T 15: 89,047,013 (GRCm39) C769* probably null Het
Plxnc1 G T 10: 94,779,529 (GRCm39) D304E probably benign Het
Prkg2 T C 5: 99,172,310 (GRCm39) D135G possibly damaging Het
Ptprb A G 10: 116,153,448 (GRCm39) D635G probably benign Het
Rapgef6 T G 11: 54,443,684 (GRCm39) V89G probably benign Het
Ror2 T A 13: 53,271,366 (GRCm39) T330S probably benign Het
Ros1 A G 10: 51,943,164 (GRCm39) V2050A possibly damaging Het
Serpinb6e T C 13: 34,021,733 (GRCm39) probably benign Het
Skp2 C A 15: 9,113,786 (GRCm39) G376C probably damaging Het
Smarca4 T C 9: 21,597,358 (GRCm39) V1371A possibly damaging Het
Syvn1 G A 19: 6,100,560 (GRCm39) R317H probably damaging Het
Tdo2 T A 3: 81,876,812 (GRCm39) D139V probably damaging Het
Tmem130 A G 5: 144,689,236 (GRCm39) V135A possibly damaging Het
Tpr A T 1: 150,317,870 (GRCm39) Q2126L probably benign Het
Txlnb A G 10: 17,706,062 (GRCm39) M324V possibly damaging Het
Ubxn10 A G 4: 138,448,574 (GRCm39) M34T possibly damaging Het
Vmn2r95 T C 17: 18,659,717 (GRCm39) W154R possibly damaging Het
Other mutations in Mrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mrc1 APN 2 14,333,236 (GRCm39) missense probably damaging 1.00
IGL01326:Mrc1 APN 2 14,271,335 (GRCm39) missense probably damaging 1.00
IGL01340:Mrc1 APN 2 14,314,895 (GRCm39) critical splice donor site probably null
IGL01758:Mrc1 APN 2 14,243,059 (GRCm39) missense probably damaging 1.00
IGL01799:Mrc1 APN 2 14,243,187 (GRCm39) missense probably damaging 1.00
IGL02280:Mrc1 APN 2 14,249,024 (GRCm39) missense probably benign 0.19
IGL02435:Mrc1 APN 2 14,253,671 (GRCm39) nonsense probably null
IGL03073:Mrc1 APN 2 14,310,153 (GRCm39) missense probably damaging 1.00
IGL03110:Mrc1 APN 2 14,298,289 (GRCm39) nonsense probably null
IGL03155:Mrc1 APN 2 14,335,912 (GRCm39) missense probably benign 0.00
IGL03289:Mrc1 APN 2 14,313,634 (GRCm39) critical splice donor site probably null
amlodipine UTSW 2 14,275,016 (GRCm39) missense probably damaging 1.00
losartan UTSW 2 14,299,597 (GRCm39) splice site probably null
Shug UTSW 2 14,275,017 (GRCm39) missense probably damaging 1.00
sussigkeit UTSW 2 14,330,192 (GRCm39) splice site probably null
R0011:Mrc1 UTSW 2 14,266,148 (GRCm39) critical splice donor site probably null
R0011:Mrc1 UTSW 2 14,266,148 (GRCm39) critical splice donor site probably null
R0066:Mrc1 UTSW 2 14,266,011 (GRCm39) missense probably benign 0.42
R0066:Mrc1 UTSW 2 14,266,011 (GRCm39) missense probably benign 0.42
R0110:Mrc1 UTSW 2 14,243,353 (GRCm39) splice site probably benign
R0234:Mrc1 UTSW 2 14,284,705 (GRCm39) missense possibly damaging 0.65
R0234:Mrc1 UTSW 2 14,284,705 (GRCm39) missense possibly damaging 0.65
R0381:Mrc1 UTSW 2 14,312,720 (GRCm39) missense probably benign 0.05
R0505:Mrc1 UTSW 2 14,314,843 (GRCm39) missense probably damaging 1.00
R0539:Mrc1 UTSW 2 14,274,937 (GRCm39) splice site probably benign
R0613:Mrc1 UTSW 2 14,299,630 (GRCm39) missense probably damaging 0.96
R0626:Mrc1 UTSW 2 14,333,382 (GRCm39) nonsense probably null
R1122:Mrc1 UTSW 2 14,266,147 (GRCm39) critical splice donor site probably null
R1281:Mrc1 UTSW 2 14,298,321 (GRCm39) missense probably damaging 1.00
R1399:Mrc1 UTSW 2 14,284,736 (GRCm39) missense probably damaging 1.00
R1428:Mrc1 UTSW 2 14,320,074 (GRCm39) missense probably benign 0.11
R1571:Mrc1 UTSW 2 14,313,544 (GRCm39) missense probably damaging 0.97
R1596:Mrc1 UTSW 2 14,253,701 (GRCm39) missense possibly damaging 0.91
R1730:Mrc1 UTSW 2 14,332,655 (GRCm39) missense probably benign 0.01
R1733:Mrc1 UTSW 2 14,261,910 (GRCm39) missense probably damaging 1.00
R1783:Mrc1 UTSW 2 14,332,655 (GRCm39) missense probably benign 0.01
R1860:Mrc1 UTSW 2 14,333,390 (GRCm39) missense probably benign 0.30
R1872:Mrc1 UTSW 2 14,330,192 (GRCm39) splice site probably null
R1889:Mrc1 UTSW 2 14,313,488 (GRCm39) critical splice acceptor site probably null
R1938:Mrc1 UTSW 2 14,324,052 (GRCm39) missense possibly damaging 0.89
R1971:Mrc1 UTSW 2 14,249,103 (GRCm39) critical splice donor site probably null
R2136:Mrc1 UTSW 2 14,275,000 (GRCm39) missense probably damaging 1.00
R2152:Mrc1 UTSW 2 14,332,675 (GRCm39) missense probably damaging 1.00
R2168:Mrc1 UTSW 2 14,249,015 (GRCm39) missense possibly damaging 0.90
R2273:Mrc1 UTSW 2 14,330,183 (GRCm39) missense probably damaging 1.00
R2901:Mrc1 UTSW 2 14,333,354 (GRCm39) missense possibly damaging 0.94
R3767:Mrc1 UTSW 2 14,323,981 (GRCm39) missense probably damaging 1.00
R3795:Mrc1 UTSW 2 14,293,793 (GRCm39) splice site probably benign
R4028:Mrc1 UTSW 2 14,243,059 (GRCm39) missense probably damaging 1.00
R4668:Mrc1 UTSW 2 14,298,297 (GRCm39) missense probably damaging 1.00
R4828:Mrc1 UTSW 2 14,275,017 (GRCm39) missense probably damaging 1.00
R4897:Mrc1 UTSW 2 14,323,952 (GRCm39) missense probably benign 0.01
R4950:Mrc1 UTSW 2 14,276,091 (GRCm39) missense probably damaging 1.00
R5000:Mrc1 UTSW 2 14,249,000 (GRCm39) missense probably damaging 1.00
R5068:Mrc1 UTSW 2 14,311,327 (GRCm39) missense probably benign 0.00
R5279:Mrc1 UTSW 2 14,314,869 (GRCm39) missense probably damaging 0.99
R5366:Mrc1 UTSW 2 14,326,725 (GRCm39) missense probably benign 0.03
R5436:Mrc1 UTSW 2 14,271,326 (GRCm39) missense probably damaging 1.00
R5552:Mrc1 UTSW 2 14,284,768 (GRCm39) missense probably benign 0.05
R5631:Mrc1 UTSW 2 14,333,383 (GRCm39) nonsense probably null
R5831:Mrc1 UTSW 2 14,313,523 (GRCm39) missense probably damaging 0.99
R5978:Mrc1 UTSW 2 14,320,204 (GRCm39) missense probably damaging 0.97
R5993:Mrc1 UTSW 2 14,310,138 (GRCm39) missense probably damaging 1.00
R6030:Mrc1 UTSW 2 14,321,712 (GRCm39) missense probably benign 0.04
R6030:Mrc1 UTSW 2 14,321,712 (GRCm39) missense probably benign 0.04
R6038:Mrc1 UTSW 2 14,261,882 (GRCm39) missense probably damaging 1.00
R6038:Mrc1 UTSW 2 14,261,882 (GRCm39) missense probably damaging 1.00
R6228:Mrc1 UTSW 2 14,276,115 (GRCm39) missense probably benign 0.08
R6344:Mrc1 UTSW 2 14,248,985 (GRCm39) missense probably damaging 1.00
R6457:Mrc1 UTSW 2 14,275,016 (GRCm39) missense probably damaging 1.00
R6520:Mrc1 UTSW 2 14,312,760 (GRCm39) missense probably damaging 1.00
R6619:Mrc1 UTSW 2 14,299,597 (GRCm39) splice site probably null
R6631:Mrc1 UTSW 2 14,243,296 (GRCm39) missense probably benign
R6737:Mrc1 UTSW 2 14,276,088 (GRCm39) missense possibly damaging 0.95
R6782:Mrc1 UTSW 2 14,266,148 (GRCm39) critical splice donor site probably null
R6887:Mrc1 UTSW 2 14,330,048 (GRCm39) missense possibly damaging 0.94
R7108:Mrc1 UTSW 2 14,308,957 (GRCm39) nonsense probably null
R7120:Mrc1 UTSW 2 14,313,508 (GRCm39) missense probably damaging 0.97
R7460:Mrc1 UTSW 2 14,253,680 (GRCm39) missense probably damaging 1.00
R7567:Mrc1 UTSW 2 14,330,104 (GRCm39) missense probably damaging 1.00
R7606:Mrc1 UTSW 2 14,242,955 (GRCm39) missense probably damaging 1.00
R7725:Mrc1 UTSW 2 14,284,788 (GRCm39) missense probably benign 0.03
R7826:Mrc1 UTSW 2 14,299,668 (GRCm39) missense probably damaging 1.00
R8082:Mrc1 UTSW 2 14,253,771 (GRCm39) missense probably benign
R8279:Mrc1 UTSW 2 14,271,168 (GRCm39) missense possibly damaging 0.89
R8888:Mrc1 UTSW 2 14,312,760 (GRCm39) missense probably damaging 1.00
R8895:Mrc1 UTSW 2 14,312,760 (GRCm39) missense probably damaging 1.00
R8952:Mrc1 UTSW 2 14,253,735 (GRCm39) missense probably damaging 0.98
R9315:Mrc1 UTSW 2 14,248,969 (GRCm39) nonsense probably null
R9366:Mrc1 UTSW 2 14,321,709 (GRCm39) missense probably damaging 0.99
R9373:Mrc1 UTSW 2 14,274,999 (GRCm39) missense probably damaging 0.99
R9418:Mrc1 UTSW 2 14,234,358 (GRCm39) missense probably benign 0.12
R9420:Mrc1 UTSW 2 14,312,790 (GRCm39) missense possibly damaging 0.53
R9489:Mrc1 UTSW 2 14,324,110 (GRCm39) missense probably benign 0.06
R9564:Mrc1 UTSW 2 14,266,117 (GRCm39) missense probably benign 0.00
R9572:Mrc1 UTSW 2 14,234,334 (GRCm39) missense probably benign
R9605:Mrc1 UTSW 2 14,324,110 (GRCm39) missense probably benign 0.06
R9606:Mrc1 UTSW 2 14,313,517 (GRCm39) missense probably benign 0.01
R9781:Mrc1 UTSW 2 14,310,175 (GRCm39) missense possibly damaging 0.90
R9781:Mrc1 UTSW 2 14,249,100 (GRCm39) missense probably benign
Z1177:Mrc1 UTSW 2 14,293,927 (GRCm39) missense probably damaging 1.00
Z1177:Mrc1 UTSW 2 14,248,949 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTAAACCTAAAGATGGTCATGA -3'
(R):5'- TGGAGATTCCCCAACCTCC -3'

Sequencing Primer
(F):5'- AAGAAAGAGTGCTTTTACTGAATTTG -3'
(R):5'- GGAGATTCCCCAACCTCCTTTTG -3'
Posted On 2014-08-25