Incidental Mutation 'R0138:Rnf213'
ID22122
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Namering finger protein 213
SynonymsD11Ertd759e
MMRRC Submission 038423-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0138 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location119393100-119487418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119416496 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 661 (C661R)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
Predicted Effect probably benign
Transcript: ENSMUST00000093902
AA Change: C661R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: C661R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131035
AA Change: C661R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: C661R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
defame UTSW 11 119430281 nonsense probably null
Derogate UTSW 11 119470210 missense probably damaging 1.00
dinky UTSW 11 119416458 missense probably damaging 0.99
Impugn UTSW 11 119436823 nonsense probably null
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0008:Rnf213 UTSW 11 119465052 missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119437750 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1789:Rnf213 UTSW 11 119440221 missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119431685 missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119480895 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2109:Rnf213 UTSW 11 119442663 nonsense probably null
R2115:Rnf213 UTSW 11 119428013 missense probably benign 0.00
R2126:Rnf213 UTSW 11 119450201 missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense probably benign 0.27
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119437604 splice site probably null
R7170:Rnf213 UTSW 11 119452575 missense
R7185:Rnf213 UTSW 11 119424198 missense
R7239:Rnf213 UTSW 11 119458788 missense
R7258:Rnf213 UTSW 11 119452575 missense
R7259:Rnf213 UTSW 11 119452575 missense
R7260:Rnf213 UTSW 11 119452575 missense
R7273:Rnf213 UTSW 11 119431756 splice site probably null
R7282:Rnf213 UTSW 11 119437992 missense
R7311:Rnf213 UTSW 11 119416547 missense
R7352:Rnf213 UTSW 11 119443579 missense
R7369:Rnf213 UTSW 11 119430468 missense
R7410:Rnf213 UTSW 11 119435051 missense
R7448:Rnf213 UTSW 11 119481291 missense
R7561:Rnf213 UTSW 11 119441719 missense
R7573:Rnf213 UTSW 11 119458484 missense
R7615:Rnf213 UTSW 11 119467297 missense
R7680:Rnf213 UTSW 11 119479556 missense
R7739:Rnf213 UTSW 11 119410861 missense
R7789:Rnf213 UTSW 11 119470219 splice site probably null
R7806:Rnf213 UTSW 11 119411545 missense
R8031:Rnf213 UTSW 11 119430281 nonsense probably null
R8042:Rnf213 UTSW 11 119441654 missense
R8053:Rnf213 UTSW 11 119402647 missense
R8284:Rnf213 UTSW 11 119428083 missense
R8301:Rnf213 UTSW 11 119434742 missense
R8325:Rnf213 UTSW 11 119430445 missense
R8332:Rnf213 UTSW 11 119483698 missense
R8443:Rnf213 UTSW 11 119449323 missense
R8518:Rnf213 UTSW 11 119462217 missense
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119441410 missense
Z1176:Rnf213 UTSW 11 119482998 missense
Predicted Primers PCR Primer
(F):5'- AGACTTGAAAGTCACATCAGGCGG -3'
(R):5'- CAGAGGTGCAGCTCTTCAGCTTAC -3'

Sequencing Primer
(F):5'- GGGCTGGAATAACCTGACTTTC -3'
(R):5'- CAGCTTACCTAGTGGGTGC -3'
Posted On2013-04-12