Incidental Mutation 'R1973:Nos1'
ID221226
Institutional Source Beutler Lab
Gene Symbol Nos1
Ensembl Gene ENSMUSG00000029361
Gene Namenitric oxide synthase 1, neuronal
SynonymsbNOS, nNOS, 2310005C01Rik, Nos-1, NO
MMRRC Submission 039986-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1973 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location117781032-117958840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117936426 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1046 (T1046A)
Ref Sequence ENSEMBL: ENSMUSP00000099617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086451] [ENSMUST00000102557] [ENSMUST00000142742] [ENSMUST00000171055]
Predicted Effect probably benign
Transcript: ENSMUST00000086451
AA Change: T1012A

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138506
Gene: ENSMUSG00000029361
AA Change: T1012A

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 1e-226 PFAM
Pfam:Flavodoxin_1 757 930 3.5e-56 PFAM
Pfam:FAD_binding_1 985 1214 1.1e-84 PFAM
Pfam:NAD_binding_1 1246 1360 2.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102557
AA Change: T1046A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099617
Gene: ENSMUSG00000029361
AA Change: T1046A

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 350 712 2e-196 PFAM
Pfam:Flavodoxin_1 757 964 2.3e-55 PFAM
Pfam:FAD_binding_1 1019 1248 2.9e-88 PFAM
Pfam:NAD_binding_1 1280 1394 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142742
AA Change: T1012A

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120421
Gene: ENSMUSG00000029361
AA Change: T1012A

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171055
AA Change: T1012A

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127432
Gene: ENSMUSG00000029361
AA Change: T1012A

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182216
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice exhibit enlarged stomachs, abnormal pyloric and lower esophageal sphincters, age-related cardiac hypertrophy, altered alcohol consumption and responses, decreased ovulation and reduced REM sleep. Homozygous null mice display increased neurogenesis in the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A C 5: 8,812,746 I143L probably benign Het
Acp7 T A 7: 28,607,989 D481V probably damaging Het
AI597479 T A 1: 43,111,126 I132K probably benign Het
Anxa13 T C 15: 58,356,181 noncoding transcript Het
Brca1 A T 11: 101,526,403 C302S probably benign Het
Brd8 T A 18: 34,608,013 D420V probably damaging Het
Cacna1g A T 11: 94,459,777 V414E possibly damaging Het
Ccdc142 T A 6: 83,102,563 C294S probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chd6 A G 2: 160,966,387 S1636P probably damaging Het
Clec4a1 A G 6: 122,924,834 probably null Het
Col6a3 A T 1: 90,804,175 I1452N probably damaging Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Dscr3 T C 16: 94,501,546 N267S probably damaging Het
Efl1 T C 7: 82,762,877 S825P probably damaging Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Faxc G A 4: 21,993,405 E350K probably benign Het
Frem2 T A 3: 53,652,232 Y1618F probably benign Het
Fubp3 A G 2: 31,603,286 T6A probably benign Het
Gm5814 A T 17: 47,410,549 M63L probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Kcnh3 T C 15: 99,229,400 V359A probably damaging Het
Kit G A 5: 75,615,442 A295T probably damaging Het
Krt77 G T 15: 101,861,244 A397E probably damaging Het
Mis18bp1 G C 12: 65,149,076 S638* probably null Het
Neurl4 C T 11: 69,909,292 P1091S probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nsfl1c G T 2: 151,505,414 S202I probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Nwd1 T C 8: 72,704,962 V1195A possibly damaging Het
Olfr243 T A 7: 103,716,597 M1K probably null Het
Olfr370 T C 8: 83,541,792 V216A probably benign Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Olfr919 A G 9: 38,697,868 V170A probably damaging Het
Pclo G T 5: 14,676,059 probably null Het
Pnpla7 A G 2: 25,016,617 D664G probably damaging Het
Prl8a1 G A 13: 27,576,934 T105I probably benign Het
Ptger1 C A 8: 83,669,454 T380K probably benign Het
Ptk7 G A 17: 46,586,807 Q282* probably null Het
Ptpn18 G T 1: 34,463,109 D45Y probably damaging Het
Rab11fip3 T C 17: 26,024,391 D589G probably damaging Het
Rara A G 11: 98,971,670 N299S possibly damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Rslcan18 T C 13: 67,108,023 probably benign Het
Rtel1 A G 2: 181,351,626 Y731C probably benign Het
Sec16a A T 2: 26,426,489 S1666R probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc10a7 T A 8: 78,697,333 probably null Het
Slc22a7 A G 17: 46,437,090 V214A probably damaging Het
Slc26a8 T C 17: 28,663,605 I249V probably benign Het
Slc38a4 T C 15: 96,999,597 K446E probably benign Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spef2 T G 15: 9,663,066 *876C probably null Het
Spink11 A G 18: 44,196,138 C14R unknown Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tnfaip3 T C 10: 19,004,504 N605S probably damaging Het
Trpc1 A G 9: 95,723,255 M283T probably benign Het
Ttn A G 2: 76,714,362 S32799P probably damaging Het
Ttn A G 2: 76,720,099 I31613T probably damaging Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Usp32 G T 11: 85,103,931 L52I probably benign Het
Usp33 A G 3: 152,360,286 T68A possibly damaging Het
Vmn1r7 A G 6: 57,025,026 F83S probably benign Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr43 A G 17: 71,640,240 N364D probably benign Het
Zdbf2 C A 1: 63,309,701 P2413Q unknown Het
Other mutations in Nos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nos1 APN 5 117910100 missense probably damaging 0.99
IGL01155:Nos1 APN 5 117945926 missense probably damaging 0.99
IGL01462:Nos1 APN 5 117867709 missense probably benign 0.10
IGL01464:Nos1 APN 5 117943192 missense probably damaging 1.00
IGL01620:Nos1 APN 5 117905309 critical splice acceptor site probably null
IGL01621:Nos1 APN 5 117945884 missense probably damaging 1.00
IGL01796:Nos1 APN 5 117938274 nonsense probably null
IGL02003:Nos1 APN 5 117905465 missense probably damaging 1.00
IGL02274:Nos1 APN 5 117897780 missense probably damaging 1.00
IGL02885:Nos1 APN 5 117895790 missense probably damaging 1.00
IGL02947:Nos1 APN 5 117943317 missense probably damaging 0.99
IGL03088:Nos1 APN 5 117867258 missense probably damaging 1.00
IGL03166:Nos1 APN 5 117914452 splice site probably benign
Crumple UTSW 5 117895860 missense possibly damaging 0.95
penurious UTSW 5 117895902 missense probably damaging 0.97
spendthrift UTSW 5 117953783 splice site probably benign
squanderer UTSW 5 117910238 missense probably damaging 0.97
R0007:Nos1 UTSW 5 117910088 missense probably damaging 1.00
R0012:Nos1 UTSW 5 117893902 missense probably damaging 1.00
R0080:Nos1 UTSW 5 117893878 missense probably damaging 1.00
R0212:Nos1 UTSW 5 117910212 missense possibly damaging 0.57
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0454:Nos1 UTSW 5 117943320 missense probably benign 0.00
R0494:Nos1 UTSW 5 117905474 missense probably damaging 1.00
R0882:Nos1 UTSW 5 117947447 missense probably damaging 1.00
R1099:Nos1 UTSW 5 117923395 missense probably damaging 0.96
R1243:Nos1 UTSW 5 117905472 missense probably damaging 1.00
R1387:Nos1 UTSW 5 117953783 splice site probably benign
R1432:Nos1 UTSW 5 117949619 splice site probably benign
R1698:Nos1 UTSW 5 117867232 missense probably benign 0.01
R1710:Nos1 UTSW 5 117895919 missense probably damaging 1.00
R1859:Nos1 UTSW 5 117905462 missense possibly damaging 0.83
R2084:Nos1 UTSW 5 117943245 missense probably damaging 1.00
R2112:Nos1 UTSW 5 117936571 missense probably benign 0.00
R4689:Nos1 UTSW 5 117879385 missense probably benign 0.04
R4769:Nos1 UTSW 5 117943245 nonsense probably null
R4893:Nos1 UTSW 5 117952877 missense possibly damaging 0.50
R4916:Nos1 UTSW 5 117947570 critical splice donor site probably null
R4956:Nos1 UTSW 5 117947510 missense probably benign
R4971:Nos1 UTSW 5 117943834 missense probably benign 0.05
R4987:Nos1 UTSW 5 117926533 critical splice donor site probably null
R5015:Nos1 UTSW 5 117867269 missense probably damaging 1.00
R5031:Nos1 UTSW 5 117879313 missense probably benign
R5137:Nos1 UTSW 5 117905313 missense probably benign 0.29
R5481:Nos1 UTSW 5 117867754 missense probably benign 0.06
R5541:Nos1 UTSW 5 117905394 missense probably damaging 1.00
R5655:Nos1 UTSW 5 117923257 missense probably damaging 1.00
R5866:Nos1 UTSW 5 117895902 missense probably damaging 0.97
R5934:Nos1 UTSW 5 117936445 missense probably damaging 0.99
R6158:Nos1 UTSW 5 117867574 missense probably benign 0.05
R6225:Nos1 UTSW 5 117912852 missense probably damaging 1.00
R6261:Nos1 UTSW 5 117936570 missense probably benign
R6388:Nos1 UTSW 5 117914436 missense possibly damaging 0.91
R6987:Nos1 UTSW 5 117895785 missense probably benign 0.05
R7104:Nos1 UTSW 5 117947431 missense probably damaging 1.00
R7136:Nos1 UTSW 5 117895860 missense possibly damaging 0.95
R7276:Nos1 UTSW 5 117910238 missense probably damaging 0.97
R7299:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7301:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7402:Nos1 UTSW 5 117949815 missense probably benign 0.34
R7408:Nos1 UTSW 5 117867518 missense probably damaging 1.00
R7618:Nos1 UTSW 5 117903944 missense probably benign 0.01
R7689:Nos1 UTSW 5 117897727 missense probably damaging 0.98
R7964:Nos1 UTSW 5 117900542 missense probably damaging 1.00
X0025:Nos1 UTSW 5 117943825 missense probably benign 0.00
X0026:Nos1 UTSW 5 117943152 missense probably damaging 1.00
Z1177:Nos1 UTSW 5 117923278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATGATGGAGAGCTGACTG -3'
(R):5'- TGCAGCTAGAAGCCTTACCC -3'

Sequencing Primer
(F):5'- CTGACTGGAGGAGCTTGGCAG -3'
(R):5'- AAGCCTTACCCAGAGCCGTG -3'
Posted On2014-08-25