Incidental Mutation 'R1973:Clec4a1'
ID221232
Institutional Source Beutler Lab
Gene Symbol Clec4a1
Ensembl Gene ENSMUSG00000049037
Gene NameC-type lectin domain family 4, member a1
SynonymsmDcir4
MMRRC Submission 039986-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1973 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122921848-122934619 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 122924834 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060484] [ENSMUST00000060484] [ENSMUST00000060484]
Predicted Effect probably null
Transcript: ENSMUST00000060484
SMART Domains Protein: ENSMUSP00000062441
Gene: ENSMUSG00000049037

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
CLECT 114 239 8.08e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060484
SMART Domains Protein: ENSMUSP00000062441
Gene: ENSMUSG00000049037

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
CLECT 114 239 8.08e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060484
SMART Domains Protein: ENSMUSP00000062441
Gene: ENSMUSG00000049037

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
CLECT 114 239 8.08e-29 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A C 5: 8,812,746 I143L probably benign Het
Acp7 T A 7: 28,607,989 D481V probably damaging Het
AI597479 T A 1: 43,111,126 I132K probably benign Het
Anxa13 T C 15: 58,356,181 noncoding transcript Het
Brca1 A T 11: 101,526,403 C302S probably benign Het
Brd8 T A 18: 34,608,013 D420V probably damaging Het
Cacna1g A T 11: 94,459,777 V414E possibly damaging Het
Ccdc142 T A 6: 83,102,563 C294S probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chd6 A G 2: 160,966,387 S1636P probably damaging Het
Col6a3 A T 1: 90,804,175 I1452N probably damaging Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Dscr3 T C 16: 94,501,546 N267S probably damaging Het
Efl1 T C 7: 82,762,877 S825P probably damaging Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Faxc G A 4: 21,993,405 E350K probably benign Het
Frem2 T A 3: 53,652,232 Y1618F probably benign Het
Fubp3 A G 2: 31,603,286 T6A probably benign Het
Gm5814 A T 17: 47,410,549 M63L probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Kcnh3 T C 15: 99,229,400 V359A probably damaging Het
Kit G A 5: 75,615,442 A295T probably damaging Het
Krt77 G T 15: 101,861,244 A397E probably damaging Het
Mis18bp1 G C 12: 65,149,076 S638* probably null Het
Neurl4 C T 11: 69,909,292 P1091S probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nos1 A G 5: 117,936,426 T1046A possibly damaging Het
Nsfl1c G T 2: 151,505,414 S202I probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Nwd1 T C 8: 72,704,962 V1195A possibly damaging Het
Olfr243 T A 7: 103,716,597 M1K probably null Het
Olfr370 T C 8: 83,541,792 V216A probably benign Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Olfr919 A G 9: 38,697,868 V170A probably damaging Het
Pclo G T 5: 14,676,059 probably null Het
Pnpla7 A G 2: 25,016,617 D664G probably damaging Het
Prl8a1 G A 13: 27,576,934 T105I probably benign Het
Ptger1 C A 8: 83,669,454 T380K probably benign Het
Ptk7 G A 17: 46,586,807 Q282* probably null Het
Ptpn18 G T 1: 34,463,109 D45Y probably damaging Het
Rab11fip3 T C 17: 26,024,391 D589G probably damaging Het
Rara A G 11: 98,971,670 N299S possibly damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Rslcan18 T C 13: 67,108,023 probably benign Het
Rtel1 A G 2: 181,351,626 Y731C probably benign Het
Sec16a A T 2: 26,426,489 S1666R probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc10a7 T A 8: 78,697,333 probably null Het
Slc22a7 A G 17: 46,437,090 V214A probably damaging Het
Slc26a8 T C 17: 28,663,605 I249V probably benign Het
Slc38a4 T C 15: 96,999,597 K446E probably benign Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spef2 T G 15: 9,663,066 *876C probably null Het
Spink11 A G 18: 44,196,138 C14R unknown Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tnfaip3 T C 10: 19,004,504 N605S probably damaging Het
Trpc1 A G 9: 95,723,255 M283T probably benign Het
Ttn A G 2: 76,714,362 S32799P probably damaging Het
Ttn A G 2: 76,720,099 I31613T probably damaging Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Usp32 G T 11: 85,103,931 L52I probably benign Het
Usp33 A G 3: 152,360,286 T68A possibly damaging Het
Vmn1r7 A G 6: 57,025,026 F83S probably benign Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr43 A G 17: 71,640,240 N364D probably benign Het
Zdbf2 C A 1: 63,309,701 P2413Q unknown Het
Other mutations in Clec4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Clec4a1 APN 6 122922055 missense possibly damaging 0.53
IGL00932:Clec4a1 APN 6 122930695 missense probably damaging 1.00
IGL01973:Clec4a1 APN 6 122930721 missense probably damaging 1.00
IGL01976:Clec4a1 APN 6 122928074 splice site probably benign
IGL02009:Clec4a1 APN 6 122932216 missense probably benign 0.09
IGL02629:Clec4a1 APN 6 122932147 critical splice acceptor site probably null
IGL03180:Clec4a1 APN 6 122924818 missense probably benign 0.08
R4582:Clec4a1 UTSW 6 122932191 missense possibly damaging 0.58
R4758:Clec4a1 UTSW 6 122933866 missense probably damaging 0.97
R4937:Clec4a1 UTSW 6 122930695 missense probably damaging 1.00
R5362:Clec4a1 UTSW 6 122932237 missense probably damaging 1.00
R6247:Clec4a1 UTSW 6 122928042 missense probably benign 0.10
R6748:Clec4a1 UTSW 6 122933897 missense possibly damaging 0.72
R7387:Clec4a1 UTSW 6 122922057 missense possibly damaging 0.91
R7481:Clec4a1 UTSW 6 122928039 missense probably damaging 1.00
R7733:Clec4a1 UTSW 6 122932150 missense possibly damaging 0.93
Z1177:Clec4a1 UTSW 6 122933892 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGGACACTCAAACTCTCCTTC -3'
(R):5'- CTACCGAGGAGACACAGATCCAT -3'

Sequencing Primer
(F):5'- ACTCTCCTTCAAGATAAAATTGTCCC -3'
(R):5'- CCTCGGTACTAGAATCCAATGTAG -3'
Posted On2014-08-25