Incidental Mutation 'R2031:Olfr697'
ID221233
Institutional Source Beutler Lab
Gene Symbol Olfr697
Ensembl Gene ENSMUSG00000051591
Gene Nameolfactory receptor 697
SynonymsGA_x6K02T2PBJ9-9119301-9118348, MOR283-5
MMRRC Submission 040038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2031 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106740834-106742443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106741898 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 12 (F12S)
Ref Sequence ENSEMBL: ENSMUSP00000152039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050541] [ENSMUST00000217734]
Predicted Effect probably damaging
Transcript: ENSMUST00000050541
AA Change: F12S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055207
Gene: ENSMUSG00000051591
AA Change: F12S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.7e-7 PFAM
Pfam:7tm_1 41 290 8.7e-26 PFAM
Pfam:7TM_GPCR_Srx 69 306 4.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217734
AA Change: F12S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3375 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,055 N642K possibly damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Arhgap28 G T 17: 67,896,116 T114N probably damaging Het
Arid5b A G 10: 68,278,688 probably null Het
Atp10a T A 7: 58,827,930 C1292* probably null Het
Casp4 A G 9: 5,321,401 S51G probably benign Het
Cast T C 13: 74,798,652 probably null Het
Ccdc87 T C 19: 4,841,687 F736L probably damaging Het
Cdon T C 9: 35,504,074 S1203P probably damaging Het
Cep290 G A 10: 100,512,400 probably null Het
Cep85 A G 4: 134,132,450 V634A probably benign Het
Cpeb3 C T 19: 37,044,679 R589H probably damaging Het
Crebrf T G 17: 26,742,921 S331A probably damaging Het
Cul5 A G 9: 53,667,180 V36A probably benign Het
Dock2 T A 11: 34,727,470 probably benign Het
Doxl2 T C 6: 48,975,855 V238A probably damaging Het
Dstyk G A 1: 132,453,191 A475T probably damaging Het
Enpp6 C A 8: 47,053,614 P151Q probably damaging Het
Fan1 A G 7: 64,354,424 Y765H probably damaging Het
Hsfy2 A T 1: 56,636,317 S354T probably benign Het
Ifi204 A C 1: 173,752,777 F389C probably damaging Het
Ikbip T C 10: 91,096,612 Y373H probably benign Het
Kbtbd11 C A 8: 15,028,021 P207T possibly damaging Het
Krt73 A C 15: 101,798,764 probably benign Het
Mfsd6 T A 1: 52,708,854 Q284L probably benign Het
Mmp1b T A 9: 7,368,607 D415V possibly damaging Het
Mrc1 A T 2: 14,321,773 T1161S probably damaging Het
Ms4a18 A G 19: 11,013,650 S27P probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mycbp2 G T 14: 103,188,592 R2366S probably damaging Het
Nfkbia A G 12: 55,491,152 L172P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr1212 A G 2: 88,959,299 T278A probably benign Het
Olfr1436 A T 19: 12,298,376 V252D probably damaging Het
Olfr1466 T C 19: 13,342,406 L216S probably benign Het
Olfr412 A G 11: 74,364,951 Y94C probably damaging Het
Olfr585 A G 7: 103,098,164 Y141C probably damaging Het
Parvb A T 15: 84,282,835 Y117F probably benign Het
Plch2 A G 4: 155,043,027 probably benign Het
Plxnb2 A T 15: 89,162,810 C769* probably null Het
Plxnc1 G T 10: 94,943,667 D304E probably benign Het
Prkg2 T C 5: 99,024,451 D135G possibly damaging Het
Ptprb A G 10: 116,317,543 D635G probably benign Het
Rapgef6 T G 11: 54,552,858 V89G probably benign Het
Ror2 T A 13: 53,117,330 T330S probably benign Het
Ros1 A G 10: 52,067,068 V2050A possibly damaging Het
Serpinb6e T C 13: 33,837,750 probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Smarca4 T C 9: 21,686,062 V1371A possibly damaging Het
Syvn1 G A 19: 6,050,530 R317H probably damaging Het
Tdo2 T A 3: 81,969,505 D139V probably damaging Het
Tmem130 A G 5: 144,752,426 V135A possibly damaging Het
Tpr A T 1: 150,442,119 Q2126L probably benign Het
Txlnb A G 10: 17,830,314 M324V possibly damaging Het
Ubxn10 A G 4: 138,721,263 M34T possibly damaging Het
Vmn2r95 T C 17: 18,439,455 W154R possibly damaging Het
Other mutations in Olfr697
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr697 APN 7 106741701 missense probably benign 0.20
IGL00937:Olfr697 APN 7 106741157 missense probably damaging 1.00
IGL01368:Olfr697 APN 7 106741622 missense probably benign 0.19
IGL01410:Olfr697 APN 7 106741499 missense probably benign 0.19
IGL01415:Olfr697 APN 7 106741499 missense probably benign 0.19
IGL01962:Olfr697 APN 7 106741784 missense probably benign 0.12
IGL02654:Olfr697 APN 7 106741348 nonsense probably null
IGL02903:Olfr697 APN 7 106741710 missense probably damaging 1.00
IGL03347:Olfr697 APN 7 106740970 utr 3 prime probably benign
IGL03391:Olfr697 APN 7 106741755 missense probably damaging 1.00
R0139:Olfr697 UTSW 7 106741625 missense probably benign 0.05
R0142:Olfr697 UTSW 7 106741765 missense probably benign 0.36
R1293:Olfr697 UTSW 7 106741851 missense probably damaging 0.98
R1522:Olfr697 UTSW 7 106741005 missense probably benign 0.03
R1715:Olfr697 UTSW 7 106741548 missense probably damaging 1.00
R1959:Olfr697 UTSW 7 106741394 missense probably damaging 1.00
R1960:Olfr697 UTSW 7 106741394 missense probably damaging 1.00
R4790:Olfr697 UTSW 7 106741791 missense probably benign 0.05
R5550:Olfr697 UTSW 7 106741133 missense probably benign 0.01
R6232:Olfr697 UTSW 7 106741554 missense probably damaging 0.96
R6293:Olfr697 UTSW 7 106741406 missense probably damaging 1.00
R6643:Olfr697 UTSW 7 106741704 missense probably benign 0.06
R7831:Olfr697 UTSW 7 106741413 missense probably damaging 0.99
R7914:Olfr697 UTSW 7 106741413 missense probably damaging 0.99
R8013:Olfr697 UTSW 7 106741617 missense probably benign 0.00
R8014:Olfr697 UTSW 7 106741617 missense probably benign 0.00
RF018:Olfr697 UTSW 7 106741485 missense probably benign 0.02
X0020:Olfr697 UTSW 7 106741136 missense probably damaging 0.97
Z1088:Olfr697 UTSW 7 106741143 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ATGACAGCTTTGGGAGTAATGAC -3'
(R):5'- AGGGTAGAGCTGAGTATCATTTCC -3'

Sequencing Primer
(F):5'- ACAGCTTTGGGAGTAATGACTGATG -3'
(R):5'- GAGCTGAGTATCATTTCCAAATCAG -3'
Posted On2014-08-25