Incidental Mutation 'R1973:Rpl13a'
ID221236
Institutional Source Beutler Lab
Gene Symbol Rpl13a
Ensembl Gene ENSMUSG00000074129
Gene Nameribosomal protein L13A
SynonymsTstap198-7, tum-transplantation antigen P198, tum-antigen, 1810026N22Rik
MMRRC Submission 039986-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R1973 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45125558-45128761 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 45125995 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 368 (K368*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003521] [ENSMUST00000150350] [ENSMUST00000209212] [ENSMUST00000209467] [ENSMUST00000209711] [ENSMUST00000209812] [ENSMUST00000209815] [ENSMUST00000209927] [ENSMUST00000210191] [ENSMUST00000210918] [ENSMUST00000210931] [ENSMUST00000210967] [ENSMUST00000211037] [ENSMUST00000211725]
Predicted Effect probably benign
Transcript: ENSMUST00000003521
SMART Domains Protein: ENSMUSP00000003521
Gene: ENSMUSG00000003429

DomainStartEndE-ValueType
Pfam:Ribosomal_S17_N 5 73 1.9e-40 PFAM
Pfam:Ribosomal_S17 75 144 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083944
Predicted Effect probably damaging
Transcript: ENSMUST00000124300
AA Change: K408I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122044
Gene: ENSMUSG00000074129
AA Change: K408I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Flt3_lig 30 162 3.8e-65 PFAM
transmembrane domain 189 211 N/A INTRINSIC
Pfam:Ribosomal_L13 226 338 1e-10 PFAM
low complexity region 389 400 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150350
AA Change: K188I

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115722
Gene: ENSMUSG00000074129
AA Change: K188I

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 6 122 7e-27 PFAM
low complexity region 169 180 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152970
AA Change: K368*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198528
Predicted Effect probably benign
Transcript: ENSMUST00000209212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209340
Predicted Effect probably damaging
Transcript: ENSMUST00000209467
AA Change: K431I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209626
Predicted Effect probably damaging
Transcript: ENSMUST00000209711
AA Change: K116I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209812
Predicted Effect probably benign
Transcript: ENSMUST00000209815
Predicted Effect probably benign
Transcript: ENSMUST00000209838
Predicted Effect probably damaging
Transcript: ENSMUST00000209927
AA Change: K162I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210175
Predicted Effect probably benign
Transcript: ENSMUST00000210191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210832
Predicted Effect probably benign
Transcript: ENSMUST00000210918
Predicted Effect possibly damaging
Transcript: ENSMUST00000210931
AA Change: K54I

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000210967
Predicted Effect possibly damaging
Transcript: ENSMUST00000211037
AA Change: K118I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211583
Predicted Effect probably benign
Transcript: ENSMUST00000211725
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes lacking snoRNAs encoded by introns of this gene show altered mitochondrial metabolism, lower reactive oxygen species tone, enhanced glucose-stimulated insulin secretion and glucose tolerance, reduced oxidative stress responses in pancreatic islets, and resistance to diabetogenic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A C 5: 8,812,746 I143L probably benign Het
Acp7 T A 7: 28,607,989 D481V probably damaging Het
AI597479 T A 1: 43,111,126 I132K probably benign Het
Anxa13 T C 15: 58,356,181 noncoding transcript Het
Brca1 A T 11: 101,526,403 C302S probably benign Het
Brd8 T A 18: 34,608,013 D420V probably damaging Het
Cacna1g A T 11: 94,459,777 V414E possibly damaging Het
Ccdc142 T A 6: 83,102,563 C294S probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chd6 A G 2: 160,966,387 S1636P probably damaging Het
Clec4a1 A G 6: 122,924,834 probably null Het
Col6a3 A T 1: 90,804,175 I1452N probably damaging Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Dscr3 T C 16: 94,501,546 N267S probably damaging Het
Efl1 T C 7: 82,762,877 S825P probably damaging Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Faxc G A 4: 21,993,405 E350K probably benign Het
Frem2 T A 3: 53,652,232 Y1618F probably benign Het
Fubp3 A G 2: 31,603,286 T6A probably benign Het
Gm5814 A T 17: 47,410,549 M63L probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Kcnh3 T C 15: 99,229,400 V359A probably damaging Het
Kit G A 5: 75,615,442 A295T probably damaging Het
Krt77 G T 15: 101,861,244 A397E probably damaging Het
Mis18bp1 G C 12: 65,149,076 S638* probably null Het
Neurl4 C T 11: 69,909,292 P1091S probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nos1 A G 5: 117,936,426 T1046A possibly damaging Het
Nsfl1c G T 2: 151,505,414 S202I probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Nwd1 T C 8: 72,704,962 V1195A possibly damaging Het
Olfr243 T A 7: 103,716,597 M1K probably null Het
Olfr370 T C 8: 83,541,792 V216A probably benign Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Olfr919 A G 9: 38,697,868 V170A probably damaging Het
Pclo G T 5: 14,676,059 probably null Het
Pnpla7 A G 2: 25,016,617 D664G probably damaging Het
Prl8a1 G A 13: 27,576,934 T105I probably benign Het
Ptger1 C A 8: 83,669,454 T380K probably benign Het
Ptk7 G A 17: 46,586,807 Q282* probably null Het
Ptpn18 G T 1: 34,463,109 D45Y probably damaging Het
Rab11fip3 T C 17: 26,024,391 D589G probably damaging Het
Rara A G 11: 98,971,670 N299S possibly damaging Het
Rslcan18 T C 13: 67,108,023 probably benign Het
Rtel1 A G 2: 181,351,626 Y731C probably benign Het
Sec16a A T 2: 26,426,489 S1666R probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc10a7 T A 8: 78,697,333 probably null Het
Slc22a7 A G 17: 46,437,090 V214A probably damaging Het
Slc26a8 T C 17: 28,663,605 I249V probably benign Het
Slc38a4 T C 15: 96,999,597 K446E probably benign Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spef2 T G 15: 9,663,066 *876C probably null Het
Spink11 A G 18: 44,196,138 C14R unknown Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tnfaip3 T C 10: 19,004,504 N605S probably damaging Het
Trpc1 A G 9: 95,723,255 M283T probably benign Het
Ttn A G 2: 76,714,362 S32799P probably damaging Het
Ttn A G 2: 76,720,099 I31613T probably damaging Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Usp32 G T 11: 85,103,931 L52I probably benign Het
Usp33 A G 3: 152,360,286 T68A possibly damaging Het
Vmn1r7 A G 6: 57,025,026 F83S probably benign Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr43 A G 17: 71,640,240 N364D probably benign Het
Zdbf2 C A 1: 63,309,701 P2413Q unknown Het
Other mutations in Rpl13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Rpl13a APN 7 45127071 unclassified probably null
R1972:Rpl13a UTSW 7 45125995 nonsense probably null
R4501:Rpl13a UTSW 7 45126140 missense probably benign 0.13
R4674:Rpl13a UTSW 7 45126818 unclassified probably benign
R4675:Rpl13a UTSW 7 45126818 unclassified probably benign
R5151:Rpl13a UTSW 7 45125961 missense probably benign 0.35
R7565:Rpl13a UTSW 7 45127042 missense probably benign 0.05
R7667:Rpl13a UTSW 7 45126173 missense probably damaging 0.96
R7699:Rpl13a UTSW 7 45127236 missense probably benign 0.12
R7700:Rpl13a UTSW 7 45127236 missense probably benign 0.12
Z1088:Rpl13a UTSW 7 45127513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAACTGATTCATCCCATGG -3'
(R):5'- AGCCACTCTGGAGGAGAAAC -3'

Sequencing Primer
(F):5'- GTGCGCTGTCAGCTCTCTAATG -3'
(R):5'- CCACTCTGGAGGAGAAACGGAAG -3'
Posted On2014-08-25