Incidental Mutation 'R1973:Efl1'
ID 221241
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission 039986-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R1973 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82412085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 825 (S825P)
Ref Sequence ENSEMBL: ENSMUSP00000137061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: S825P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: S825P

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: S825P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: S825P

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A C 5: 8,862,746 (GRCm39) I143L probably benign Het
Acp7 T A 7: 28,307,414 (GRCm39) D481V probably damaging Het
AI597479 T A 1: 43,150,286 (GRCm39) I132K probably benign Het
Anxa13 T C 15: 58,228,030 (GRCm39) noncoding transcript Het
Brca1 A T 11: 101,417,229 (GRCm39) C302S probably benign Het
Brd8 T A 18: 34,741,066 (GRCm39) D420V probably damaging Het
Cacna1g A T 11: 94,350,603 (GRCm39) V414E possibly damaging Het
Ccdc142 T A 6: 83,079,544 (GRCm39) C294S probably benign Het
Cdh20 G A 1: 109,988,862 (GRCm39) V255I probably benign Het
Chat C T 14: 32,146,148 (GRCm39) V342I probably benign Het
Chd6 A G 2: 160,808,307 (GRCm39) S1636P probably damaging Het
Clec4a1 A G 6: 122,901,793 (GRCm39) probably null Het
Col6a3 A T 1: 90,731,897 (GRCm39) I1452N probably damaging Het
Dennd2c T C 3: 103,039,014 (GRCm39) V54A probably benign Het
Dnah1 C T 14: 30,987,348 (GRCm39) W3550* probably null Het
Entrep2 A T 7: 64,425,516 (GRCm39) I192N possibly damaging Het
Faxc G A 4: 21,993,405 (GRCm39) E350K probably benign Het
Frem2 T A 3: 53,559,653 (GRCm39) Y1618F probably benign Het
Fubp3 A G 2: 31,493,298 (GRCm39) T6A probably benign Het
Gm5814 A T 17: 47,721,474 (GRCm39) M63L probably benign Het
Gpr149 T C 3: 62,438,216 (GRCm39) K647R probably benign Het
Iqgap3 T A 3: 87,991,235 (GRCm39) probably null Het
Kcnh3 T C 15: 99,127,281 (GRCm39) V359A probably damaging Het
Kit G A 5: 75,776,102 (GRCm39) A295T probably damaging Het
Krt77 G T 15: 101,769,679 (GRCm39) A397E probably damaging Het
Mis18bp1 G C 12: 65,195,850 (GRCm39) S638* probably null Het
Neurl4 C T 11: 69,800,118 (GRCm39) P1091S probably benign Het
Nod2 A T 8: 89,379,501 (GRCm39) M8L probably damaging Het
Nos1 A G 5: 118,074,491 (GRCm39) T1046A possibly damaging Het
Nsfl1c G T 2: 151,347,334 (GRCm39) S202I probably damaging Het
Nuak2 A T 1: 132,258,340 (GRCm39) H257L probably damaging Het
Nwd1 T C 8: 73,431,590 (GRCm39) V1195A possibly damaging Het
Or10k2 T C 8: 84,268,421 (GRCm39) V216A probably benign Het
Or2ag12 T C 7: 106,277,426 (GRCm39) D89G probably benign Het
Or52a20 T A 7: 103,365,804 (GRCm39) M1K probably null Het
Or8b40 T A 9: 38,027,863 (GRCm39) M257K possibly damaging Het
Or8g51 A G 9: 38,609,164 (GRCm39) V170A probably damaging Het
Pclo G T 5: 14,726,073 (GRCm39) probably null Het
Pnpla7 A G 2: 24,906,629 (GRCm39) D664G probably damaging Het
Prl8a1 G A 13: 27,760,917 (GRCm39) T105I probably benign Het
Ptger1 C A 8: 84,396,083 (GRCm39) T380K probably benign Het
Ptk7 G A 17: 46,897,733 (GRCm39) Q282* probably null Het
Ptpn18 G T 1: 34,502,190 (GRCm39) D45Y probably damaging Het
Rab11fip3 T C 17: 26,243,365 (GRCm39) D589G probably damaging Het
Rara A G 11: 98,862,496 (GRCm39) N299S possibly damaging Het
Rpl13a T A 7: 44,775,419 (GRCm39) K368* probably null Het
Rslcan18 T C 13: 67,256,087 (GRCm39) probably benign Het
Rtel1 A G 2: 180,993,419 (GRCm39) Y731C probably benign Het
Sec16a A T 2: 26,316,501 (GRCm39) S1666R probably damaging Het
Sis A G 3: 72,828,337 (GRCm39) F1217S probably damaging Het
Slc10a7 T A 8: 79,423,962 (GRCm39) probably null Het
Slc22a7 A G 17: 46,748,016 (GRCm39) V214A probably damaging Het
Slc26a8 T C 17: 28,882,579 (GRCm39) I249V probably benign Het
Slc38a4 T C 15: 96,897,478 (GRCm39) K446E probably benign Het
Sned1 G A 1: 93,192,795 (GRCm39) G361S probably damaging Het
Spef2 T G 15: 9,663,152 (GRCm39) *876C probably null Het
Spink11 A G 18: 44,329,205 (GRCm39) C14R unknown Het
Stk4 C T 2: 163,942,448 (GRCm39) T360M probably benign Het
Tnfaip3 T C 10: 18,880,252 (GRCm39) N605S probably damaging Het
Trpc1 A G 9: 95,605,308 (GRCm39) M283T probably benign Het
Ttn A G 2: 76,544,706 (GRCm39) S32799P probably damaging Het
Ttn A G 2: 76,550,443 (GRCm39) I31613T probably damaging Het
Ugt1a10 A T 1: 87,983,769 (GRCm39) Y189F probably damaging Het
Usp32 G T 11: 84,994,757 (GRCm39) L52I probably benign Het
Usp33 A G 3: 152,065,923 (GRCm39) T68A possibly damaging Het
Vmn1r7 A G 6: 57,002,011 (GRCm39) F83S probably benign Het
Vmn2r5 C T 3: 64,411,642 (GRCm39) E309K probably damaging Het
Vps26c T C 16: 94,302,405 (GRCm39) N267S probably damaging Het
Wdr43 A G 17: 71,947,235 (GRCm39) N364D probably benign Het
Zdbf2 C A 1: 63,348,860 (GRCm39) P2413Q unknown Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGCGACTTGATTCGTTCC -3'
(R):5'- TGACCTTGGTGCTGTTTATCAC -3'

Sequencing Primer
(F):5'- CGACTTGATTCGTTCCATGGAGC -3'
(R):5'- ATGAGCGGCTCCTCACACATG -3'
Posted On 2014-08-25