Incidental Mutation 'R1973:Olfr693'
ID221244
Institutional Source Beutler Lab
Gene Symbol Olfr693
Ensembl Gene ENSMUSG00000051680
Gene Nameolfactory receptor 693
SynonymsGA_x6K02T2PBJ9-9055944-9054994, MOR283-8
MMRRC Submission 039986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R1973 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106675005-106680584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106678219 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 89 (D89G)
Ref Sequence ENSEMBL: ENSMUSP00000150203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057817] [ENSMUST00000215541]
Predicted Effect probably benign
Transcript: ENSMUST00000057817
AA Change: D89G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000059679
Gene: ENSMUSG00000051680
AA Change: D89G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.2e-48 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215541
AA Change: D89G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A C 5: 8,812,746 I143L probably benign Het
Acp7 T A 7: 28,607,989 D481V probably damaging Het
AI597479 T A 1: 43,111,126 I132K probably benign Het
Anxa13 T C 15: 58,356,181 noncoding transcript Het
Brca1 A T 11: 101,526,403 C302S probably benign Het
Brd8 T A 18: 34,608,013 D420V probably damaging Het
Cacna1g A T 11: 94,459,777 V414E possibly damaging Het
Ccdc142 T A 6: 83,102,563 C294S probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chd6 A G 2: 160,966,387 S1636P probably damaging Het
Clec4a1 A G 6: 122,924,834 probably null Het
Col6a3 A T 1: 90,804,175 I1452N probably damaging Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Dscr3 T C 16: 94,501,546 N267S probably damaging Het
Efl1 T C 7: 82,762,877 S825P probably damaging Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Faxc G A 4: 21,993,405 E350K probably benign Het
Frem2 T A 3: 53,652,232 Y1618F probably benign Het
Fubp3 A G 2: 31,603,286 T6A probably benign Het
Gm5814 A T 17: 47,410,549 M63L probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Kcnh3 T C 15: 99,229,400 V359A probably damaging Het
Kit G A 5: 75,615,442 A295T probably damaging Het
Krt77 G T 15: 101,861,244 A397E probably damaging Het
Mis18bp1 G C 12: 65,149,076 S638* probably null Het
Neurl4 C T 11: 69,909,292 P1091S probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nos1 A G 5: 117,936,426 T1046A possibly damaging Het
Nsfl1c G T 2: 151,505,414 S202I probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Nwd1 T C 8: 72,704,962 V1195A possibly damaging Het
Olfr243 T A 7: 103,716,597 M1K probably null Het
Olfr370 T C 8: 83,541,792 V216A probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Olfr919 A G 9: 38,697,868 V170A probably damaging Het
Pclo G T 5: 14,676,059 probably null Het
Pnpla7 A G 2: 25,016,617 D664G probably damaging Het
Prl8a1 G A 13: 27,576,934 T105I probably benign Het
Ptger1 C A 8: 83,669,454 T380K probably benign Het
Ptk7 G A 17: 46,586,807 Q282* probably null Het
Ptpn18 G T 1: 34,463,109 D45Y probably damaging Het
Rab11fip3 T C 17: 26,024,391 D589G probably damaging Het
Rara A G 11: 98,971,670 N299S possibly damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Rslcan18 T C 13: 67,108,023 probably benign Het
Rtel1 A G 2: 181,351,626 Y731C probably benign Het
Sec16a A T 2: 26,426,489 S1666R probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc10a7 T A 8: 78,697,333 probably null Het
Slc22a7 A G 17: 46,437,090 V214A probably damaging Het
Slc26a8 T C 17: 28,663,605 I249V probably benign Het
Slc38a4 T C 15: 96,999,597 K446E probably benign Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spef2 T G 15: 9,663,066 *876C probably null Het
Spink11 A G 18: 44,196,138 C14R unknown Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tnfaip3 T C 10: 19,004,504 N605S probably damaging Het
Trpc1 A G 9: 95,723,255 M283T probably benign Het
Ttn A G 2: 76,714,362 S32799P probably damaging Het
Ttn A G 2: 76,720,099 I31613T probably damaging Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Usp32 G T 11: 85,103,931 L52I probably benign Het
Usp33 A G 3: 152,360,286 T68A possibly damaging Het
Vmn1r7 A G 6: 57,025,026 F83S probably benign Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr43 A G 17: 71,640,240 N364D probably benign Het
Zdbf2 C A 1: 63,309,701 P2413Q unknown Het
Other mutations in Olfr693
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Olfr693 APN 7 106677833 missense probably damaging 1.00
IGL01135:Olfr693 APN 7 106678193 missense probably benign 0.41
IGL03247:Olfr693 APN 7 106677547 missense probably benign 0.01
R0206:Olfr693 UTSW 7 106677574 missense probably benign 0.03
R1125:Olfr693 UTSW 7 106678007 missense possibly damaging 0.46
R1873:Olfr693 UTSW 7 106678484 start codon destroyed probably damaging 1.00
R1969:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1970:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1971:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1972:Olfr693 UTSW 7 106678219 missense probably benign 0.01
R2570:Olfr693 UTSW 7 106677667 missense probably benign 0.41
R3975:Olfr693 UTSW 7 106677785 missense probably damaging 1.00
R4840:Olfr693 UTSW 7 106678123 missense probably damaging 1.00
R5569:Olfr693 UTSW 7 106678483 start codon destroyed probably null 1.00
R6759:Olfr693 UTSW 7 106677893 missense probably benign
R6842:Olfr693 UTSW 7 106677886 missense probably damaging 1.00
R7108:Olfr693 UTSW 7 106678048 missense probably benign 0.03
R7565:Olfr693 UTSW 7 106678126 missense probably damaging 1.00
R7800:Olfr693 UTSW 7 106677574 missense probably benign 0.03
X0025:Olfr693 UTSW 7 106678249 missense probably damaging 1.00
Z1088:Olfr693 UTSW 7 106678457 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGTATATCCCAGGGCACTCAG -3'
(R):5'- GTGCTACAATTGCTGCCCTG -3'

Sequencing Primer
(F):5'- TATATCCCAGGGCACTCAGAGAAG -3'
(R):5'- CCTGTACATGTTGGCACTGATCAG -3'
Posted On2014-08-25