Incidental Mutation 'R2031:Cul5'
ID221248
Institutional Source Beutler Lab
Gene Symbol Cul5
Ensembl Gene ENSMUSG00000032030
Gene Namecullin 5
SynonymsVACM-1, C030032G03Rik, C330021I08Rik, 8430423K24Rik, 4921514I20Rik
MMRRC Submission 040038-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2031 (G1)
Quality Score162
Status Validated
Chromosome9
Chromosomal Location53614582-53670014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53667180 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 36 (V36A)
Ref Sequence ENSEMBL: ENSMUSP00000133144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034529] [ENSMUST00000120122] [ENSMUST00000166367]
Predicted Effect probably benign
Transcript: ENSMUST00000034529
AA Change: V36A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034529
Gene: ENSMUSG00000032030
AA Change: V36A

DomainStartEndE-ValueType
PDB:2WZK|A 76 461 N/A PDB
SCOP:d1ldja2 91 459 1e-109 SMART
CULLIN 510 661 1.12e-80 SMART
Cullin_Nedd8 782 849 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120122
SMART Domains Protein: ENSMUSP00000113490
Gene: ENSMUSG00000032030

DomainStartEndE-ValueType
PDB:4JGH|D 1 258 N/A PDB
SCOP:d1ldja2 5 255 2e-75 SMART
CULLIN 306 457 1.12e-80 SMART
Cullin_Nedd8 578 645 5.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123499
Predicted Effect probably benign
Transcript: ENSMUST00000133872
SMART Domains Protein: ENSMUSP00000121734
Gene: ENSMUSG00000032030

DomainStartEndE-ValueType
PDB:2WZK|A 5 49 4e-25 PDB
SCOP:d1ldja2 20 49 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146938
Predicted Effect probably benign
Transcript: ENSMUST00000166367
AA Change: V36A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133144
Gene: ENSMUSG00000032030
AA Change: V36A

DomainStartEndE-ValueType
PDB:2WZK|A 76 434 N/A PDB
SCOP:d1ldja2 91 432 9e-99 SMART
CULLIN 483 634 1.12e-80 SMART
Cullin_Nedd8 755 822 5.12e-17 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality. Mice heterozygous for a null allele exhibit decreased susceptibility to LPS-induced lung injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,055 N642K possibly damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Arhgap28 G T 17: 67,896,116 T114N probably damaging Het
Arid5b A G 10: 68,278,688 probably null Het
Atp10a T A 7: 58,827,930 C1292* probably null Het
Casp4 A G 9: 5,321,401 S51G probably benign Het
Cast T C 13: 74,798,652 probably null Het
Ccdc87 T C 19: 4,841,687 F736L probably damaging Het
Cdon T C 9: 35,504,074 S1203P probably damaging Het
Cep290 G A 10: 100,512,400 probably null Het
Cep85 A G 4: 134,132,450 V634A probably benign Het
Cpeb3 C T 19: 37,044,679 R589H probably damaging Het
Crebrf T G 17: 26,742,921 S331A probably damaging Het
Dock2 T A 11: 34,727,470 probably benign Het
Doxl2 T C 6: 48,975,855 V238A probably damaging Het
Dstyk G A 1: 132,453,191 A475T probably damaging Het
Enpp6 C A 8: 47,053,614 P151Q probably damaging Het
Fan1 A G 7: 64,354,424 Y765H probably damaging Het
Hsfy2 A T 1: 56,636,317 S354T probably benign Het
Ifi204 A C 1: 173,752,777 F389C probably damaging Het
Ikbip T C 10: 91,096,612 Y373H probably benign Het
Kbtbd11 C A 8: 15,028,021 P207T possibly damaging Het
Krt73 A C 15: 101,798,764 probably benign Het
Mfsd6 T A 1: 52,708,854 Q284L probably benign Het
Mmp1b T A 9: 7,368,607 D415V possibly damaging Het
Mrc1 A T 2: 14,321,773 T1161S probably damaging Het
Ms4a18 A G 19: 11,013,650 S27P probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mycbp2 G T 14: 103,188,592 R2366S probably damaging Het
Nfkbia A G 12: 55,491,152 L172P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr1212 A G 2: 88,959,299 T278A probably benign Het
Olfr1436 A T 19: 12,298,376 V252D probably damaging Het
Olfr1466 T C 19: 13,342,406 L216S probably benign Het
Olfr412 A G 11: 74,364,951 Y94C probably damaging Het
Olfr585 A G 7: 103,098,164 Y141C probably damaging Het
Olfr697 A G 7: 106,741,898 F12S probably damaging Het
Parvb A T 15: 84,282,835 Y117F probably benign Het
Plch2 A G 4: 155,043,027 probably benign Het
Plxnb2 A T 15: 89,162,810 C769* probably null Het
Plxnc1 G T 10: 94,943,667 D304E probably benign Het
Prkg2 T C 5: 99,024,451 D135G possibly damaging Het
Ptprb A G 10: 116,317,543 D635G probably benign Het
Rapgef6 T G 11: 54,552,858 V89G probably benign Het
Ror2 T A 13: 53,117,330 T330S probably benign Het
Ros1 A G 10: 52,067,068 V2050A possibly damaging Het
Serpinb6e T C 13: 33,837,750 probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Smarca4 T C 9: 21,686,062 V1371A possibly damaging Het
Syvn1 G A 19: 6,050,530 R317H probably damaging Het
Tdo2 T A 3: 81,969,505 D139V probably damaging Het
Tmem130 A G 5: 144,752,426 V135A possibly damaging Het
Tpr A T 1: 150,442,119 Q2126L probably benign Het
Txlnb A G 10: 17,830,314 M324V possibly damaging Het
Ubxn10 A G 4: 138,721,263 M34T possibly damaging Het
Vmn2r95 T C 17: 18,439,455 W154R possibly damaging Het
Other mutations in Cul5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Cul5 APN 9 53635007 missense probably damaging 1.00
IGL02043:Cul5 APN 9 53658673 missense probably benign 0.26
IGL02145:Cul5 APN 9 53635075 splice site probably benign
IGL02261:Cul5 APN 9 53635037 missense probably damaging 1.00
IGL02281:Cul5 APN 9 53635049 missense possibly damaging 0.87
IGL02639:Cul5 APN 9 53655342 missense possibly damaging 0.89
IGL02697:Cul5 APN 9 53655331 missense probably benign
IGL02752:Cul5 APN 9 53634978 missense probably damaging 0.98
IGL03017:Cul5 APN 9 53644485 critical splice donor site probably null
IGL03031:Cul5 APN 9 53642675 splice site probably benign
IGL03196:Cul5 APN 9 53625880 missense probably damaging 0.99
R0142:Cul5 UTSW 9 53635050 missense probably damaging 0.98
R0415:Cul5 UTSW 9 53667070 missense probably benign 0.00
R1619:Cul5 UTSW 9 53658593 missense probably benign 0.00
R1675:Cul5 UTSW 9 53646683 missense probably benign 0.00
R2059:Cul5 UTSW 9 53667156 missense probably damaging 0.98
R3401:Cul5 UTSW 9 53621212 missense probably benign 0.02
R3427:Cul5 UTSW 9 53617890 missense probably benign
R3701:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3702:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3815:Cul5 UTSW 9 53622943 missense probably benign 0.31
R3848:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3849:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3850:Cul5 UTSW 9 53617986 missense probably benign 0.34
R4592:Cul5 UTSW 9 53633727 splice site probably benign
R4690:Cul5 UTSW 9 53622871 missense probably damaging 1.00
R5154:Cul5 UTSW 9 53625867 missense probably damaging 1.00
R5173:Cul5 UTSW 9 53642734 missense probably benign
R5645:Cul5 UTSW 9 53622943 missense probably benign 0.17
R5868:Cul5 UTSW 9 53658673 missense probably benign 0.26
R5975:Cul5 UTSW 9 53622793 missense probably damaging 1.00
R6251:Cul5 UTSW 9 53646794 missense probably benign 0.40
R6284:Cul5 UTSW 9 53623735 missense probably damaging 1.00
R6415:Cul5 UTSW 9 53646683 missense probably benign 0.00
R7178:Cul5 UTSW 9 53644526 missense probably benign 0.01
R7511:Cul5 UTSW 9 53625969 missense probably damaging 1.00
X0018:Cul5 UTSW 9 53622929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAAGAGTCACAATGATGG -3'
(R):5'- AAGTGGCTACTACCTCTTCCCG -3'

Sequencing Primer
(F):5'- TGGTCCCTTGAAAGCATCG -3'
(R):5'- TCTTCCCGGTCTGGTCGG -3'
Posted On2014-08-25