Mutagenetix > Incidental Mutation

Incidental Mutation 'R2031:Cep290'

221261

Institutional Source

Beutler Lab

Gene Symbol

Cep290

Ensembl Gene

ENSMUSG00000019971

Gene Name

centrosomal protein 290

Synonyms

b2b1454Clo, Nphp6, b2b1752Clo

MMRRC Submission

040038-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R2031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100487558-100574840 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 100512400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]

AlphaFold

Q6A078

Predicted Effect

probably null
Transcript: ENSMUST00000164751

SMART Domains

Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971

Domain	Start	End	E-Value	Type
coiled coil region	59	298	N/A	INTRINSIC
coiled coil region	319	566	N/A	INTRINSIC
coiled coil region	598	662	N/A	INTRINSIC
coiled coil region	697	754	N/A	INTRINSIC
coiled coil region	780	875	N/A	INTRINSIC
internal_repeat_2	884	894	1.1e-5	PROSPERO
coiled coil region	986	1028	N/A	INTRINSIC
internal_repeat_2	1057	1067	1.1e-5	PROSPERO
coiled coil region	1071	1109	N/A	INTRINSIC
low complexity region	1140	1156	N/A	INTRINSIC
internal_repeat_1	1176	1206	8.72e-8	PROSPERO
coiled coil region	1221	1250	N/A	INTRINSIC
Pfam:CEP209_CC5	1290	1417	3.8e-55	PFAM
low complexity region	1476	1493	N/A	INTRINSIC
internal_repeat_1	1498	1525	8.72e-8	PROSPERO
coiled coil region	1535	1595	N/A	INTRINSIC
coiled coil region	1624	1716	N/A	INTRINSIC
coiled coil region	1776	2328	N/A	INTRINSIC
low complexity region	2333	2347	N/A	INTRINSIC
coiled coil region	2377	2453	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000219765

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220331

Predicted Effect

probably null
Transcript: ENSMUST00000220346

Meta Mutation Damage Score

0.9482

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam1b	G	T	5: 121,501,055	N642K	possibly damaging	Het
Akap11	T	A	14: 78,510,037	I1637L	possibly damaging	Het
Arhgap28	G	T	17: 67,896,116	T114N	probably damaging	Het
Arid5b	A	G	10: 68,278,688		probably null	Het
Atp10a	T	A	7: 58,827,930	C1292*	probably null	Het
Casp4	A	G	9: 5,321,401	S51G	probably benign	Het
Cast	T	C	13: 74,798,652		probably null	Het
Ccdc87	T	C	19: 4,841,687	F736L	probably damaging	Het
Cdon	T	C	9: 35,504,074	S1203P	probably damaging	Het
Cep85	A	G	4: 134,132,450	V634A	probably benign	Het
Cpeb3	C	T	19: 37,044,679	R589H	probably damaging	Het
Crebrf	T	G	17: 26,742,921	S331A	probably damaging	Het
Cul5	A	G	9: 53,667,180	V36A	probably benign	Het
Dock2	T	A	11: 34,727,470		probably benign	Het
Doxl2	T	C	6: 48,975,855	V238A	probably damaging	Het
Dstyk	G	A	1: 132,453,191	A475T	probably damaging	Het
Enpp6	C	A	8: 47,053,614	P151Q	probably damaging	Het
Fan1	A	G	7: 64,354,424	Y765H	probably damaging	Het
Hsfy2	A	T	1: 56,636,317	S354T	probably benign	Het
Ifi204	A	C	1: 173,752,777	F389C	probably damaging	Het
Ikbip	T	C	10: 91,096,612	Y373H	probably benign	Het
Kbtbd11	C	A	8: 15,028,021	P207T	possibly damaging	Het
Krt73	A	C	15: 101,798,764		probably benign	Het
Mfsd6	T	A	1: 52,708,854	Q284L	probably benign	Het
Mmp1b	T	A	9: 7,368,607	D415V	possibly damaging	Het
Mrc1	A	T	2: 14,321,773	T1161S	probably damaging	Het
Ms4a18	A	G	19: 11,013,650	S27P	probably benign	Het
Muc6	G	A	7: 141,638,400	S2120F	possibly damaging	Het
Mycbp2	G	T	14: 103,188,592	R2366S	probably damaging	Het
Nfkbia	A	G	12: 55,491,152	L172P	probably damaging	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Olfr1212	A	G	2: 88,959,299	T278A	probably benign	Het
Olfr1436	A	T	19: 12,298,376	V252D	probably damaging	Het
Olfr1466	T	C	19: 13,342,406	L216S	probably benign	Het
Olfr412	A	G	11: 74,364,951	Y94C	probably damaging	Het
Olfr585	A	G	7: 103,098,164	Y141C	probably damaging	Het
Olfr697	A	G	7: 106,741,898	F12S	probably damaging	Het
Parvb	A	T	15: 84,282,835	Y117F	probably benign	Het
Plch2	A	G	4: 155,043,027		probably benign	Het
Plxnb2	A	T	15: 89,162,810	C769*	probably null	Het
Plxnc1	G	T	10: 94,943,667	D304E	probably benign	Het
Prkg2	T	C	5: 99,024,451	D135G	possibly damaging	Het
Ptprb	A	G	10: 116,317,543	D635G	probably benign	Het
Rapgef6	T	G	11: 54,552,858	V89G	probably benign	Het
Ror2	T	A	13: 53,117,330	T330S	probably benign	Het
Ros1	A	G	10: 52,067,068	V2050A	possibly damaging	Het
Serpinb6e	T	C	13: 33,837,750		probably benign	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Smarca4	T	C	9: 21,686,062	V1371A	possibly damaging	Het
Syvn1	G	A	19: 6,050,530	R317H	probably damaging	Het
Tdo2	T	A	3: 81,969,505	D139V	probably damaging	Het
Tmem130	A	G	5: 144,752,426	V135A	possibly damaging	Het
Tpr	A	T	1: 150,442,119	Q2126L	probably benign	Het
Txlnb	A	G	10: 17,830,314	M324V	possibly damaging	Het
Ubxn10	A	G	4: 138,721,263	M34T	possibly damaging	Het
Vmn2r95	T	C	17: 18,439,455	W154R	possibly damaging	Het

Other mutations in Cep290

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Cep290	APN	10	100508724	missense	probably benign	0.00
IGL00499:Cep290	APN	10	100543327	missense	probably damaging	1.00
IGL00547:Cep290	APN	10	100510708	missense	probably damaging	0.99
IGL00573:Cep290	APN	10	100540361	missense	probably damaging	1.00
IGL00646:Cep290	APN	10	100501154	missense	probably benign	0.15
IGL00755:Cep290	APN	10	100531104	missense	probably damaging	1.00
IGL00835:Cep290	APN	10	100563380	nonsense	probably null
IGL00846:Cep290	APN	10	100540333	splice site	probably benign
IGL00985:Cep290	APN	10	100567161	splice site	probably benign
IGL01687:Cep290	APN	10	100500205	missense	probably damaging	1.00
IGL01782:Cep290	APN	10	100545125	nonsense	probably null
IGL02010:Cep290	APN	10	100508707	missense	probably benign	0.39
IGL02010:Cep290	APN	10	100561345	missense	probably benign	0.00
IGL02036:Cep290	APN	10	100558100	nonsense	probably null
IGL02039:Cep290	APN	10	100514602	critical splice donor site	probably null
IGL02532:Cep290	APN	10	100545065	missense	probably benign	0.04
IGL02950:Cep290	APN	10	100540329	splice site	probably benign
IGL03105:Cep290	APN	10	100551824	missense	possibly damaging	0.66
IGL03179:Cep290	APN	10	100568088	missense	possibly damaging	0.60
IGL03271:Cep290	APN	10	100537801	missense	probably benign	0.09
IGL03401:Cep290	APN	10	100500265	missense	probably benign	0.27
PIT4687001:Cep290	UTSW	10	100537591	missense	probably benign	0.28
R0025:Cep290	UTSW	10	100537831	missense	probably damaging	1.00
R0127:Cep290	UTSW	10	100536925	splice site	probably benign
R0254:Cep290	UTSW	10	100514574	missense	probably benign	0.31
R0295:Cep290	UTSW	10	100537821	missense	probably damaging	0.99
R0371:Cep290	UTSW	10	100518564	splice site	probably benign
R0390:Cep290	UTSW	10	100508758	missense	probably benign	0.09
R0399:Cep290	UTSW	10	100554400	splice site	probably benign
R0413:Cep290	UTSW	10	100523314	nonsense	probably null
R0427:Cep290	UTSW	10	100516179	missense	probably benign	0.01
R0472:Cep290	UTSW	10	100551455	missense	probably benign	0.19
R0485:Cep290	UTSW	10	100549344	missense	possibly damaging	0.94
R0635:Cep290	UTSW	10	100492676	missense	probably damaging	1.00
R0675:Cep290	UTSW	10	100568813	critical splice acceptor site	probably null
R0972:Cep290	UTSW	10	100518762	missense	probably benign	0.08
R1238:Cep290	UTSW	10	100517863	missense	probably damaging	1.00
R1297:Cep290	UTSW	10	100539100	splice site	probably benign
R1368:Cep290	UTSW	10	100494966	splice site	probably benign
R1394:Cep290	UTSW	10	100537529	missense	possibly damaging	0.66
R1437:Cep290	UTSW	10	100572101	missense	probably benign	0.00
R1493:Cep290	UTSW	10	100562181	missense	probably benign	0.21
R1496:Cep290	UTSW	10	100538966	missense	probably damaging	1.00
R1539:Cep290	UTSW	10	100496828	missense	probably benign	0.06
R1598:Cep290	UTSW	10	100549329	missense	probably damaging	1.00
R1616:Cep290	UTSW	10	100568836	missense	probably benign
R1712:Cep290	UTSW	10	100554499	missense	probably benign	0.02
R1753:Cep290	UTSW	10	100513981	missense	probably benign
R1773:Cep290	UTSW	10	100510573	missense	probably benign
R1775:Cep290	UTSW	10	100496810	missense	probably damaging	0.98
R1799:Cep290	UTSW	10	100516196	missense	probably benign	0.00
R1937:Cep290	UTSW	10	100497953	missense	possibly damaging	0.71
R1991:Cep290	UTSW	10	100531184	missense	possibly damaging	0.80
R2164:Cep290	UTSW	10	100518795	missense	probably damaging	0.96
R2393:Cep290	UTSW	10	100561238	critical splice acceptor site	probably null
R2403:Cep290	UTSW	10	100537437	missense	probably benign	0.19
R3612:Cep290	UTSW	10	100541581	nonsense	probably null
R3800:Cep290	UTSW	10	100572941	missense	probably damaging	0.97
R4005:Cep290	UTSW	10	100539008	missense	probably damaging	1.00
R4039:Cep290	UTSW	10	100512401	critical splice donor site	probably null
R4259:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4260:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4319:Cep290	UTSW	10	100539047	missense	probably benign	0.09
R4329:Cep290	UTSW	10	100537668	missense	probably damaging	0.98
R4573:Cep290	UTSW	10	100518850	missense	probably benign
R4614:Cep290	UTSW	10	100508740	missense	probably benign
R4614:Cep290	UTSW	10	100559687	missense	possibly damaging	0.93
R4708:Cep290	UTSW	10	100523264	missense	probably benign	0.02
R4727:Cep290	UTSW	10	100563270	missense	probably benign	0.05
R4825:Cep290	UTSW	10	100488348	missense	probably damaging	0.96
R4839:Cep290	UTSW	10	100508786	missense	probably damaging	0.99
R4858:Cep290	UTSW	10	100494911	missense	probably benign	0.31
R4871:Cep290	UTSW	10	100548914	missense	probably benign	0.22
R5094:Cep290	UTSW	10	100567030	missense	probably damaging	0.97
R5103:Cep290	UTSW	10	100539020	missense	probably damaging	1.00
R5499:Cep290	UTSW	10	100537653	missense	probably damaging	0.99
R5505:Cep290	UTSW	10	100499186	critical splice donor site	probably null
R5615:Cep290	UTSW	10	100531150	missense	probably damaging	1.00
R5815:Cep290	UTSW	10	100558108	missense	possibly damaging	0.80
R5883:Cep290	UTSW	10	100523399	missense	probably benign	0.44
R5889:Cep290	UTSW	10	100499074	missense	possibly damaging	0.95
R5928:Cep290	UTSW	10	100551830	missense	probably damaging	0.99
R5992:Cep290	UTSW	10	100543321	missense	possibly damaging	0.73
R6000:Cep290	UTSW	10	100541787	missense	probably damaging	1.00
R6213:Cep290	UTSW	10	100523360	missense	probably benign	0.06
R6274:Cep290	UTSW	10	100530207	missense	probably damaging	1.00
R6285:Cep290	UTSW	10	100523329	missense	probably benign	0.17
R6306:Cep290	UTSW	10	100531166	missense	possibly damaging	0.89
R6593:Cep290	UTSW	10	100508776	missense	probably benign	0.01
R6649:Cep290	UTSW	10	100518531	missense	probably benign	0.28
R6692:Cep290	UTSW	10	100569144	splice site	probably null
R6788:Cep290	UTSW	10	100488628	missense	probably damaging	1.00
R6847:Cep290	UTSW	10	100563419	missense	probably damaging	1.00
R6947:Cep290	UTSW	10	100530056	missense	probably damaging	1.00
R7035:Cep290	UTSW	10	100499071	missense	probably benign	0.07
R7073:Cep290	UTSW	10	100539003	missense	possibly damaging	0.90
R7114:Cep290	UTSW	10	100543358	missense	probably damaging	0.98
R7256:Cep290	UTSW	10	100546498	missense	probably damaging	1.00
R7258:Cep290	UTSW	10	100499108	missense	probably benign	0.01
R7311:Cep290	UTSW	10	100537718	missense	probably damaging	0.98
R7505:Cep290	UTSW	10	100516265	missense	probably benign	0.01
R7615:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7643:Cep290	UTSW	10	100537553	missense	probably benign
R7662:Cep290	UTSW	10	100537803	missense	probably benign	0.21
R7663:Cep290	UTSW	10	100554536	critical splice donor site	probably null
R7685:Cep290	UTSW	10	100540057	missense	probably benign	0.19
R7699:Cep290	UTSW	10	100540369	missense	probably benign	0.33
R7717:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7747:Cep290	UTSW	10	100558176	nonsense	probably null
R7757:Cep290	UTSW	10	100563434	missense	probably benign
R7843:Cep290	UTSW	10	100516188	missense	possibly damaging	0.49
R7905:Cep290	UTSW	10	100554490	missense	probably benign
R8078:Cep290	UTSW	10	100572887	missense	probably benign	0.04
R8081:Cep290	UTSW	10	100558176	nonsense	probably null
R8094:Cep290	UTSW	10	100544931	missense	possibly damaging	0.95
R8266:Cep290	UTSW	10	100559671	missense	probably benign	0.08
R8305:Cep290	UTSW	10	100544934	missense	probably benign	0.09
R8325:Cep290	UTSW	10	100517808	missense	probably benign	0.03
R8372:Cep290	UTSW	10	100549341	missense	probably benign	0.00
R8443:Cep290	UTSW	10	100495844	missense	possibly damaging	0.80
R8497:Cep290	UTSW	10	100551458	missense	probably damaging	1.00
R8778:Cep290	UTSW	10	100514512	nonsense	probably null
R8975:Cep290	UTSW	10	100513920	missense	possibly damaging	0.54
R9146:Cep290	UTSW	10	100541803	missense	probably benign	0.44
R9264:Cep290	UTSW	10	100498016	missense	possibly damaging	0.86
R9374:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9448:Cep290	UTSW	10	100559684	missense	probably benign	0.32
R9499:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9507:Cep290	UTSW	10	100494923	missense	possibly damaging	0.81
R9539:Cep290	UTSW	10	100568851	missense	probably damaging	1.00
R9547:Cep290	UTSW	10	100544979	missense	probably benign	0.00
R9551:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9657:Cep290	UTSW	10	100515141	missense	possibly damaging	0.93
R9731:Cep290	UTSW	10	100510542	missense	probably damaging	0.98
R9756:Cep290	UTSW	10	100516172	missense	probably damaging	0.97
R9777:Cep290	UTSW	10	100518667	missense	probably benign	0.01
Z1176:Cep290	UTSW	10	100549374	critical splice donor site	probably benign
Z1177:Cep290	UTSW	10	100497944	missense	probably benign
Z1177:Cep290	UTSW	10	100538997	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGCTGCATGTTGGTCAAAG -3'
(R):5'- TGCAGCAGCTCTGTTTTAGC -3'

Sequencing Primer
(F):5'- GTAGGATTAACCATTGACGAC -3'
(R):5'- GCTGAACTCTTAATCTGTATGCAAAG -3'

Posted On

2014-08-25