Incidental Mutation 'R2031:Rapgef6'
ID 221267
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 040038-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2031 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 54522847-54699285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 54552858 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 89 (V89G)
Ref Sequence ENSEMBL: ENSMUSP00000147135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108895] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000101206
AA Change: V89G

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: V89G

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
AA Change: V89G

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: V89G

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108895
AA Change: V89G

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533
AA Change: V89G

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155132
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: V89G

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
Meta Mutation Damage Score 0.1504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,055 N642K possibly damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Arhgap28 G T 17: 67,896,116 T114N probably damaging Het
Arid5b A G 10: 68,278,688 probably null Het
Atp10a T A 7: 58,827,930 C1292* probably null Het
Casp4 A G 9: 5,321,401 S51G probably benign Het
Cast T C 13: 74,798,652 probably null Het
Ccdc87 T C 19: 4,841,687 F736L probably damaging Het
Cdon T C 9: 35,504,074 S1203P probably damaging Het
Cep290 G A 10: 100,512,400 probably null Het
Cep85 A G 4: 134,132,450 V634A probably benign Het
Cpeb3 C T 19: 37,044,679 R589H probably damaging Het
Crebrf T G 17: 26,742,921 S331A probably damaging Het
Cul5 A G 9: 53,667,180 V36A probably benign Het
Dock2 T A 11: 34,727,470 probably benign Het
Doxl2 T C 6: 48,975,855 V238A probably damaging Het
Dstyk G A 1: 132,453,191 A475T probably damaging Het
Enpp6 C A 8: 47,053,614 P151Q probably damaging Het
Fan1 A G 7: 64,354,424 Y765H probably damaging Het
Hsfy2 A T 1: 56,636,317 S354T probably benign Het
Ifi204 A C 1: 173,752,777 F389C probably damaging Het
Ikbip T C 10: 91,096,612 Y373H probably benign Het
Kbtbd11 C A 8: 15,028,021 P207T possibly damaging Het
Krt73 A C 15: 101,798,764 probably benign Het
Mfsd6 T A 1: 52,708,854 Q284L probably benign Het
Mmp1b T A 9: 7,368,607 D415V possibly damaging Het
Mrc1 A T 2: 14,321,773 T1161S probably damaging Het
Ms4a18 A G 19: 11,013,650 S27P probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mycbp2 G T 14: 103,188,592 R2366S probably damaging Het
Nfkbia A G 12: 55,491,152 L172P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr1212 A G 2: 88,959,299 T278A probably benign Het
Olfr1436 A T 19: 12,298,376 V252D probably damaging Het
Olfr1466 T C 19: 13,342,406 L216S probably benign Het
Olfr412 A G 11: 74,364,951 Y94C probably damaging Het
Olfr585 A G 7: 103,098,164 Y141C probably damaging Het
Olfr697 A G 7: 106,741,898 F12S probably damaging Het
Parvb A T 15: 84,282,835 Y117F probably benign Het
Plch2 A G 4: 155,043,027 probably benign Het
Plxnb2 A T 15: 89,162,810 C769* probably null Het
Plxnc1 G T 10: 94,943,667 D304E probably benign Het
Prkg2 T C 5: 99,024,451 D135G possibly damaging Het
Ptprb A G 10: 116,317,543 D635G probably benign Het
Ror2 T A 13: 53,117,330 T330S probably benign Het
Ros1 A G 10: 52,067,068 V2050A possibly damaging Het
Serpinb6e T C 13: 33,837,750 probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Smarca4 T C 9: 21,686,062 V1371A possibly damaging Het
Syvn1 G A 19: 6,050,530 R317H probably damaging Het
Tdo2 T A 3: 81,969,505 D139V probably damaging Het
Tmem130 A G 5: 144,752,426 V135A possibly damaging Het
Tpr A T 1: 150,442,119 Q2126L probably benign Het
Txlnb A G 10: 17,830,314 M324V possibly damaging Het
Ubxn10 A G 4: 138,721,263 M34T possibly damaging Het
Vmn2r95 T C 17: 18,439,455 W154R possibly damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 splice site probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 splice site probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54626723 missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54625958 missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54631301 nonsense probably null
R8393:Rapgef6 UTSW 11 54687661 missense probably benign
R8465:Rapgef6 UTSW 11 54691482 missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54690237 missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54568469 missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54552874 critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54691566 nonsense probably null
R8921:Rapgef6 UTSW 11 54679239 missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54687841 missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54597086 nonsense probably null
R9354:Rapgef6 UTSW 11 54619923 missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54552858 missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54691343 missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54622363 missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54649271 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAGCATTACCAGAATGTAGTC -3'
(R):5'- CCTGCCAAAATGTGCAATTGC -3'

Sequencing Primer
(F):5'- CCAGAATGTAGTCTATGCTTTGC -3'
(R):5'- GTACATTAGCTCTGAAGTAAAGAACG -3'
Posted On 2014-08-25