Incidental Mutation 'R0138:Mctp1'
ID 22127
Institutional Source Beutler Lab
Gene Symbol Mctp1
Ensembl Gene ENSMUSG00000021596
Gene Name multiple C2 domains, transmembrane 1
Synonyms
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0138 (G1)
Quality Score 196
Status Validated (trace)
Chromosome 13
Chromosomal Location 76384535-77031810 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 76827712 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 478 (R478C)
Ref Sequence ENSEMBL: ENSMUSP00000105212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109583] [ENSMUST00000125209]
AlphaFold E9PV86
Predicted Effect probably damaging
Transcript: ENSMUST00000109583
AA Change: R478C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105212
Gene: ENSMUSG00000021596
AA Change: R478C

DomainStartEndE-ValueType
C2 3 100 1.15e-15 SMART
C2 166 263 1.35e-21 SMART
C2 322 418 4.76e-22 SMART
transmembrane domain 513 535 N/A INTRINSIC
Pfam:PRT_C 542 672 3.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122843
Predicted Effect probably damaging
Transcript: ENSMUST00000125209
AA Change: R735C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118958
Gene: ENSMUSG00000021596
AA Change: R735C

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 134 174 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
C2 260 357 1.15e-15 SMART
C2 423 520 1.35e-21 SMART
C2 579 675 4.76e-22 SMART
transmembrane domain 770 792 N/A INTRINSIC
Pfam:PRT_C 800 929 2.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155275
Meta Mutation Damage Score 0.3486 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Mctp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mctp1 APN 13 77020798 missense probably damaging 0.98
IGL01355:Mctp1 APN 13 76384955 missense probably benign
IGL02192:Mctp1 APN 13 76731768 intron probably benign
IGL02342:Mctp1 APN 13 77024857 missense probably damaging 1.00
IGL02706:Mctp1 APN 13 76823069 missense probably damaging 1.00
IGL02950:Mctp1 APN 13 77024810 missense probably damaging 1.00
IGL03064:Mctp1 APN 13 76801513 nonsense probably null
IGL03230:Mctp1 APN 13 76824857 missense possibly damaging 0.49
R0355:Mctp1 UTSW 13 76824863 missense probably damaging 1.00
R0383:Mctp1 UTSW 13 76801544 missense probably damaging 1.00
R0426:Mctp1 UTSW 13 77020821 missense probably benign 0.01
R0462:Mctp1 UTSW 13 76801401 missense probably damaging 1.00
R0483:Mctp1 UTSW 13 76827727 missense probably damaging 1.00
R0685:Mctp1 UTSW 13 76825799 critical splice donor site probably null
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1854:Mctp1 UTSW 13 76825741 missense probably damaging 0.96
R1864:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1865:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1920:Mctp1 UTSW 13 76384610 missense possibly damaging 0.67
R2071:Mctp1 UTSW 13 76759724 missense probably damaging 1.00
R2127:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2128:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2129:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R3709:Mctp1 UTSW 13 76824880 splice site probably null
R4463:Mctp1 UTSW 13 76712087 missense probably damaging 1.00
R4510:Mctp1 UTSW 13 76825272 missense probably benign 0.20
R4511:Mctp1 UTSW 13 76825272 missense probably benign 0.20
R4951:Mctp1 UTSW 13 76827775 missense probably damaging 0.96
R5004:Mctp1 UTSW 13 76641804 missense possibly damaging 0.79
R5307:Mctp1 UTSW 13 76712079 critical splice acceptor site probably null
R5339:Mctp1 UTSW 13 76825706 intron probably benign
R5639:Mctp1 UTSW 13 77024783 splice site silent
R5769:Mctp1 UTSW 13 76759808 missense probably damaging 1.00
R5800:Mctp1 UTSW 13 76688559 missense probably damaging 1.00
R5913:Mctp1 UTSW 13 76759825 splice site probably null
R5981:Mctp1 UTSW 13 76757110 missense probably damaging 1.00
R6024:Mctp1 UTSW 13 76385161 missense probably damaging 0.98
R6192:Mctp1 UTSW 13 76822963 splice site probably null
R6331:Mctp1 UTSW 13 77020863 critical splice donor site probably null
R6468:Mctp1 UTSW 13 76731811 critical splice donor site probably null
R6484:Mctp1 UTSW 13 76688625 missense probably benign 0.02
R6656:Mctp1 UTSW 13 77029936 missense probably damaging 0.99
R7026:Mctp1 UTSW 13 76806259 missense probably benign 0.35
R7482:Mctp1 UTSW 13 76741460 splice site probably null
R7890:Mctp1 UTSW 13 76827757 missense probably damaging 1.00
R7942:Mctp1 UTSW 13 76641710 critical splice acceptor site probably null
R8029:Mctp1 UTSW 13 77029886 missense probably damaging 1.00
R8034:Mctp1 UTSW 13 76891551 missense probably damaging 0.99
R8085:Mctp1 UTSW 13 76824853 missense probably benign 0.00
R8258:Mctp1 UTSW 13 76801547 critical splice donor site probably null
R8259:Mctp1 UTSW 13 76801547 critical splice donor site probably null
R8286:Mctp1 UTSW 13 76757055 missense probably benign 0.22
R8713:Mctp1 UTSW 13 76641803 missense probably benign
R9029:Mctp1 UTSW 13 76688622 missense probably benign 0.36
R9218:Mctp1 UTSW 13 76723697 missense possibly damaging 0.94
Z1189:Mctp1 UTSW 13 76823042 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATTTGAAGACAGGAGCAGTCCTAGT -3'
(R):5'- GCCACAGAGACTTGGAGCTAAGATGAC -3'

Sequencing Primer
(F):5'- CTTTAAATGGTGAGCCAAGTAGC -3'
(R):5'- CTTGGAGCTAAGATGACTGAATCTG -3'
Posted On 2013-04-12