Incidental Mutation 'R2031:Ror2'
ID 221275
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Name receptor tyrosine kinase-like orphan receptor 2
Synonyms Ntrkr2
MMRRC Submission 040038-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2031 (G1)
Quality Score 193
Status Validated
Chromosome 13
Chromosomal Location 53109312-53286124 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53117330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 330 (T330S)
Ref Sequence ENSEMBL: ENSMUSP00000021918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021918
AA Change: T330S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: T330S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130235
AA Change: T318S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: T318S

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,055 N642K possibly damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Arhgap28 G T 17: 67,896,116 T114N probably damaging Het
Arid5b A G 10: 68,278,688 probably null Het
Atp10a T A 7: 58,827,930 C1292* probably null Het
Casp4 A G 9: 5,321,401 S51G probably benign Het
Cast T C 13: 74,798,652 probably null Het
Ccdc87 T C 19: 4,841,687 F736L probably damaging Het
Cdon T C 9: 35,504,074 S1203P probably damaging Het
Cep290 G A 10: 100,512,400 probably null Het
Cep85 A G 4: 134,132,450 V634A probably benign Het
Cpeb3 C T 19: 37,044,679 R589H probably damaging Het
Crebrf T G 17: 26,742,921 S331A probably damaging Het
Cul5 A G 9: 53,667,180 V36A probably benign Het
Dock2 T A 11: 34,727,470 probably benign Het
Doxl2 T C 6: 48,975,855 V238A probably damaging Het
Dstyk G A 1: 132,453,191 A475T probably damaging Het
Enpp6 C A 8: 47,053,614 P151Q probably damaging Het
Fan1 A G 7: 64,354,424 Y765H probably damaging Het
Hsfy2 A T 1: 56,636,317 S354T probably benign Het
Ifi204 A C 1: 173,752,777 F389C probably damaging Het
Ikbip T C 10: 91,096,612 Y373H probably benign Het
Kbtbd11 C A 8: 15,028,021 P207T possibly damaging Het
Krt73 A C 15: 101,798,764 probably benign Het
Mfsd6 T A 1: 52,708,854 Q284L probably benign Het
Mmp1b T A 9: 7,368,607 D415V possibly damaging Het
Mrc1 A T 2: 14,321,773 T1161S probably damaging Het
Ms4a18 A G 19: 11,013,650 S27P probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mycbp2 G T 14: 103,188,592 R2366S probably damaging Het
Nfkbia A G 12: 55,491,152 L172P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr1212 A G 2: 88,959,299 T278A probably benign Het
Olfr1436 A T 19: 12,298,376 V252D probably damaging Het
Olfr1466 T C 19: 13,342,406 L216S probably benign Het
Olfr412 A G 11: 74,364,951 Y94C probably damaging Het
Olfr585 A G 7: 103,098,164 Y141C probably damaging Het
Olfr697 A G 7: 106,741,898 F12S probably damaging Het
Parvb A T 15: 84,282,835 Y117F probably benign Het
Plch2 A G 4: 155,043,027 probably benign Het
Plxnb2 A T 15: 89,162,810 C769* probably null Het
Plxnc1 G T 10: 94,943,667 D304E probably benign Het
Prkg2 T C 5: 99,024,451 D135G possibly damaging Het
Ptprb A G 10: 116,317,543 D635G probably benign Het
Rapgef6 T G 11: 54,552,858 V89G probably benign Het
Ros1 A G 10: 52,067,068 V2050A possibly damaging Het
Serpinb6e T C 13: 33,837,750 probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Smarca4 T C 9: 21,686,062 V1371A possibly damaging Het
Syvn1 G A 19: 6,050,530 R317H probably damaging Het
Tdo2 T A 3: 81,969,505 D139V probably damaging Het
Tmem130 A G 5: 144,752,426 V135A possibly damaging Het
Tpr A T 1: 150,442,119 Q2126L probably benign Het
Txlnb A G 10: 17,830,314 M324V possibly damaging Het
Ubxn10 A G 4: 138,721,263 M34T possibly damaging Het
Vmn2r95 T C 17: 18,439,455 W154R possibly damaging Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
lavage UTSW 13 53118982 missense probably damaging 1.00
tendrils UTSW 13 53111451 missense probably damaging 0.96
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
R8031:Ror2 UTSW 13 53113157 missense probably damaging 1.00
R8479:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R8684:Ror2 UTSW 13 53110266 missense possibly damaging 0.90
R8834:Ror2 UTSW 13 53110302 small deletion probably benign
R8948:Ror2 UTSW 13 53131996 missense possibly damaging 0.67
R9233:Ror2 UTSW 13 53111554 missense probably benign
R9234:Ror2 UTSW 13 53111338 missense probably damaging 1.00
R9573:Ror2 UTSW 13 53111431 missense probably benign
R9665:Ror2 UTSW 13 53285525 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GTACGTCACACAGTTCCACG -3'
(R):5'- GGATTCAGTCCCTCTAATGCTACC -3'

Sequencing Primer
(F):5'- CGCGTACGTTTTTATTCTGCGTAAAG -3'
(R):5'- TCAGGTCACATGTAAAACCCTTAGG -3'
Posted On 2014-08-25