Mutagenetix > Incidental Mutations

Incidental Mutation 'R2031:Ror2'

221275

Institutional Source

Beutler Lab

Gene Symbol

Ror2

Ensembl Gene

ENSMUSG00000021464

Gene Name

receptor tyrosine kinase-like orphan receptor 2

Synonyms

Ntrkr2

MMRRC Submission

040038-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2031 (G1)

Quality Score

193

Status

Validated

Chromosome

Chromosomal Location

53109312-53286124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53117330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 330 (T330S)

Ref Sequence

ENSEMBL: ENSMUSP00000021918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000021918
AA Change: T330S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: T330S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
IGc2	74	142	5.23e-16	SMART
Pfam:Fz	174	294	1.2e-12	PFAM
KR	314	396	3.94e-45	SMART
transmembrane domain	403	425	N/A	INTRINSIC
TyrKc	473	746	1.96e-113	SMART
low complexity region	765	783	N/A	INTRINSIC
low complexity region	788	801	N/A	INTRINSIC
low complexity region	839	859	N/A	INTRINSIC
low complexity region	860	872	N/A	INTRINSIC
low complexity region	905	924	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130235
AA Change: T318S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: T318S

Domain	Start	End	E-Value	Type
IGc2	62	130	5.23e-16	SMART
Pfam:Fz	162	289	3.2e-26	PFAM
KR	302	384	3.94e-45	SMART
transmembrane domain	391	413	N/A	INTRINSIC
TyrKc	461	734	1.96e-113	SMART
low complexity region	753	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	893	912	N/A	INTRINSIC

Meta Mutation Damage Score

0.0687

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam1b	G	T	5: 121,501,055	N642K	possibly damaging	Het
Akap11	T	A	14: 78,510,037	I1637L	possibly damaging	Het
Arhgap28	G	T	17: 67,896,116	T114N	probably damaging	Het
Arid5b	A	G	10: 68,278,688		probably null	Het
Atp10a	T	A	7: 58,827,930	C1292*	probably null	Het
Casp4	A	G	9: 5,321,401	S51G	probably benign	Het
Cast	T	C	13: 74,798,652		probably null	Het
Ccdc87	T	C	19: 4,841,687	F736L	probably damaging	Het
Cdon	T	C	9: 35,504,074	S1203P	probably damaging	Het
Cep290	G	A	10: 100,512,400		probably null	Het
Cep85	A	G	4: 134,132,450	V634A	probably benign	Het
Cpeb3	C	T	19: 37,044,679	R589H	probably damaging	Het
Crebrf	T	G	17: 26,742,921	S331A	probably damaging	Het
Cul5	A	G	9: 53,667,180	V36A	probably benign	Het
Dock2	T	A	11: 34,727,470		probably benign	Het
Doxl2	T	C	6: 48,975,855	V238A	probably damaging	Het
Dstyk	G	A	1: 132,453,191	A475T	probably damaging	Het
Enpp6	C	A	8: 47,053,614	P151Q	probably damaging	Het
Fan1	A	G	7: 64,354,424	Y765H	probably damaging	Het
Hsfy2	A	T	1: 56,636,317	S354T	probably benign	Het
Ifi204	A	C	1: 173,752,777	F389C	probably damaging	Het
Ikbip	T	C	10: 91,096,612	Y373H	probably benign	Het
Kbtbd11	C	A	8: 15,028,021	P207T	possibly damaging	Het
Krt73	A	C	15: 101,798,764		probably benign	Het
Mfsd6	T	A	1: 52,708,854	Q284L	probably benign	Het
Mmp1b	T	A	9: 7,368,607	D415V	possibly damaging	Het
Mrc1	A	T	2: 14,321,773	T1161S	probably damaging	Het
Ms4a18	A	G	19: 11,013,650	S27P	probably benign	Het
Muc6	G	A	7: 141,638,400	S2120F	possibly damaging	Het
Mycbp2	G	T	14: 103,188,592	R2366S	probably damaging	Het
Nfkbia	A	G	12: 55,491,152	L172P	probably damaging	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Olfr1212	A	G	2: 88,959,299	T278A	probably benign	Het
Olfr1436	A	T	19: 12,298,376	V252D	probably damaging	Het
Olfr1466	T	C	19: 13,342,406	L216S	probably benign	Het
Olfr412	A	G	11: 74,364,951	Y94C	probably damaging	Het
Olfr585	A	G	7: 103,098,164	Y141C	probably damaging	Het
Olfr697	A	G	7: 106,741,898	F12S	probably damaging	Het
Parvb	A	T	15: 84,282,835	Y117F	probably benign	Het
Plch2	A	G	4: 155,043,027		probably benign	Het
Plxnb2	A	T	15: 89,162,810	C769*	probably null	Het
Plxnc1	G	T	10: 94,943,667	D304E	probably benign	Het
Prkg2	T	C	5: 99,024,451	D135G	possibly damaging	Het
Ptprb	A	G	10: 116,317,543	D635G	probably benign	Het
Rapgef6	T	G	11: 54,552,858	V89G	probably benign	Het
Ros1	A	G	10: 52,067,068	V2050A	possibly damaging	Het
Serpinb6e	T	C	13: 33,837,750		probably benign	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Smarca4	T	C	9: 21,686,062	V1371A	possibly damaging	Het
Syvn1	G	A	19: 6,050,530	R317H	probably damaging	Het
Tdo2	T	A	3: 81,969,505	D139V	probably damaging	Het
Tmem130	A	G	5: 144,752,426	V135A	possibly damaging	Het
Tpr	A	T	1: 150,442,119	Q2126L	probably benign	Het
Txlnb	A	G	10: 17,830,314	M324V	possibly damaging	Het
Ubxn10	A	G	4: 138,721,263	M34T	possibly damaging	Het
Vmn2r95	T	C	17: 18,439,455	W154R	possibly damaging	Het

Other mutations in Ror2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ror2	APN	13	53113082	missense	probably benign	0.01
IGL01523:Ror2	APN	13	53118963	missense	probably benign	0.02
IGL01599:Ror2	APN	13	53111617	missense	probably damaging	1.00
IGL01669:Ror2	APN	13	53111088	missense	probably damaging	1.00
IGL02016:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02138:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02139:Ror2	APN	13	53111164	missense	probably damaging	1.00
IGL02172:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02173:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02176:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02177:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02178:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02179:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02182:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02189:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02190:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02203:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02230:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02231:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02234:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02423:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02424:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02478:Ror2	APN	13	53121667	missense	probably damaging	1.00
IGL02479:Ror2	APN	13	53131932	missense	possibly damaging	0.62
IGL02517:Ror2	APN	13	53118840	missense	probably damaging	1.00
IGL02554:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02618:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02619:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02622:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02623:Ror2	APN	13	53110728	missense	probably damaging	1.00
lavage	UTSW	13	53118982	missense	probably damaging	1.00
tendrils	UTSW	13	53111451	missense	probably damaging	0.96
willowy	UTSW	13	53131919	missense	probably damaging	1.00
R0076:Ror2	UTSW	13	53113074	missense	probably benign	0.02
R0375:Ror2	UTSW	13	53132004	missense	probably damaging	1.00
R0826:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R1823:Ror2	UTSW	13	53110305	missense	probably benign	0.07
R1895:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1946:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1983:Ror2	UTSW	13	53110408	missense	probably benign	0.01
R2197:Ror2	UTSW	13	53285780	critical splice donor site	probably null
R2246:Ror2	UTSW	13	53111602	missense	probably damaging	1.00
R2405:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2411:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2905:Ror2	UTSW	13	53131995	missense	probably benign	0.01
R3156:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R4198:Ror2	UTSW	13	53110644	missense	probably benign	0.08
R4408:Ror2	UTSW	13	53118961	missense	probably damaging	1.00
R4469:Ror2	UTSW	13	53131980	missense	possibly damaging	0.87
R4648:Ror2	UTSW	13	53285500	nonsense	probably null
R4705:Ror2	UTSW	13	53117297	missense	probably benign	0.00
R4824:Ror2	UTSW	13	53110683	missense	probably benign	0.10
R4831:Ror2	UTSW	13	53118844	missense	probably damaging	0.97
R4951:Ror2	UTSW	13	53117147	missense	probably benign	0.00
R4975:Ror2	UTSW	13	53131918	missense	probably damaging	1.00
R5380:Ror2	UTSW	13	53117149	missense	possibly damaging	0.73
R5469:Ror2	UTSW	13	53117339	missense	probably benign	0.00
R5604:Ror2	UTSW	13	53117165	missense	probably benign	0.01
R6188:Ror2	UTSW	13	53111311	missense	probably damaging	0.98
R6221:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R6243:Ror2	UTSW	13	53113080	missense	probably benign
R6255:Ror2	UTSW	13	53110542	missense	probably damaging	1.00
R6497:Ror2	UTSW	13	53131919	missense	probably damaging	1.00
R6717:Ror2	UTSW	13	53118982	missense	probably damaging	1.00
R6918:Ror2	UTSW	13	53111451	missense	probably damaging	0.96
R7092:Ror2	UTSW	13	53110236	missense	probably benign
R7134:Ror2	UTSW	13	53146706	missense	probably benign	0.00
R7254:Ror2	UTSW	13	53118720	missense	possibly damaging	0.72
R7517:Ror2	UTSW	13	53110865	missense	possibly damaging	0.86
R7560:Ror2	UTSW	13	53110813	missense	probably benign	0.05
R7746:Ror2	UTSW	13	53117225	missense	probably damaging	1.00
R8031:Ror2	UTSW	13	53113157	missense	probably damaging	1.00
R8479:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R8684:Ror2	UTSW	13	53110266	missense	possibly damaging	0.90
R8834:Ror2	UTSW	13	53110302	small deletion	probably benign
R8948:Ror2	UTSW	13	53131996	missense	possibly damaging	0.67
R9233:Ror2	UTSW	13	53111554	missense	probably benign
R9234:Ror2	UTSW	13	53111338	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTACGTCACACAGTTCCACG -3'
(R):5'- GGATTCAGTCCCTCTAATGCTACC -3'

Sequencing Primer
(F):5'- CGCGTACGTTTTTATTCTGCGTAAAG -3'
(R):5'- TCAGGTCACATGTAAAACCCTTAGG -3'

Posted On

2014-08-25