Incidental Mutation 'R2031:Akap11'
ID221279
Institutional Source Beutler Lab
Gene Symbol Akap11
Ensembl Gene ENSMUSG00000022016
Gene NameA kinase (PRKA) anchor protein 11
Synonyms6330501D17Rik
MMRRC Submission 040038-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2031 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location78492246-78536808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78510037 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1637 (I1637L)
Ref Sequence ENSEMBL: ENSMUSP00000116015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022593] [ENSMUST00000123853]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022593
AA Change: I1637L

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022593
Gene: ENSMUSG00000022016
AA Change: I1637L

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1738 1755 N/A INTRINSIC
low complexity region 1767 1788 N/A INTRINSIC
Blast:AKAP_110 1790 1883 2e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000123853
AA Change: I1637L

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116015
Gene: ENSMUSG00000022016
AA Change: I1637L

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1731 1756 N/A INTRINSIC
low complexity region 1768 1789 N/A INTRINSIC
Blast:AKAP_110 1791 1884 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227722
Meta Mutation Damage Score 0.0965 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduction in body size, body length and tibia length, hypoactivity, slow movement and increased anxiety-related responses, and exhibit actin barrier defects in kidney collecting duct cells and increased urine osmolality in response to overhydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,055 N642K possibly damaging Het
Arhgap28 G T 17: 67,896,116 T114N probably damaging Het
Arid5b A G 10: 68,278,688 probably null Het
Atp10a T A 7: 58,827,930 C1292* probably null Het
Casp4 A G 9: 5,321,401 S51G probably benign Het
Cast T C 13: 74,798,652 probably null Het
Ccdc87 T C 19: 4,841,687 F736L probably damaging Het
Cdon T C 9: 35,504,074 S1203P probably damaging Het
Cep290 G A 10: 100,512,400 probably null Het
Cep85 A G 4: 134,132,450 V634A probably benign Het
Cpeb3 C T 19: 37,044,679 R589H probably damaging Het
Crebrf T G 17: 26,742,921 S331A probably damaging Het
Cul5 A G 9: 53,667,180 V36A probably benign Het
Dock2 T A 11: 34,727,470 probably benign Het
Doxl2 T C 6: 48,975,855 V238A probably damaging Het
Dstyk G A 1: 132,453,191 A475T probably damaging Het
Enpp6 C A 8: 47,053,614 P151Q probably damaging Het
Fan1 A G 7: 64,354,424 Y765H probably damaging Het
Hsfy2 A T 1: 56,636,317 S354T probably benign Het
Ifi204 A C 1: 173,752,777 F389C probably damaging Het
Ikbip T C 10: 91,096,612 Y373H probably benign Het
Kbtbd11 C A 8: 15,028,021 P207T possibly damaging Het
Krt73 A C 15: 101,798,764 probably benign Het
Mfsd6 T A 1: 52,708,854 Q284L probably benign Het
Mmp1b T A 9: 7,368,607 D415V possibly damaging Het
Mrc1 A T 2: 14,321,773 T1161S probably damaging Het
Ms4a18 A G 19: 11,013,650 S27P probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mycbp2 G T 14: 103,188,592 R2366S probably damaging Het
Nfkbia A G 12: 55,491,152 L172P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr1212 A G 2: 88,959,299 T278A probably benign Het
Olfr1436 A T 19: 12,298,376 V252D probably damaging Het
Olfr1466 T C 19: 13,342,406 L216S probably benign Het
Olfr412 A G 11: 74,364,951 Y94C probably damaging Het
Olfr585 A G 7: 103,098,164 Y141C probably damaging Het
Olfr697 A G 7: 106,741,898 F12S probably damaging Het
Parvb A T 15: 84,282,835 Y117F probably benign Het
Plch2 A G 4: 155,043,027 probably benign Het
Plxnb2 A T 15: 89,162,810 C769* probably null Het
Plxnc1 G T 10: 94,943,667 D304E probably benign Het
Prkg2 T C 5: 99,024,451 D135G possibly damaging Het
Ptprb A G 10: 116,317,543 D635G probably benign Het
Rapgef6 T G 11: 54,552,858 V89G probably benign Het
Ror2 T A 13: 53,117,330 T330S probably benign Het
Ros1 A G 10: 52,067,068 V2050A possibly damaging Het
Serpinb6e T C 13: 33,837,750 probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Smarca4 T C 9: 21,686,062 V1371A possibly damaging Het
Syvn1 G A 19: 6,050,530 R317H probably damaging Het
Tdo2 T A 3: 81,969,505 D139V probably damaging Het
Tmem130 A G 5: 144,752,426 V135A possibly damaging Het
Tpr A T 1: 150,442,119 Q2126L probably benign Het
Txlnb A G 10: 17,830,314 M324V possibly damaging Het
Ubxn10 A G 4: 138,721,263 M34T possibly damaging Het
Vmn2r95 T C 17: 18,439,455 W154R possibly damaging Het
Other mutations in Akap11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Akap11 APN 14 78511341 missense probably damaging 1.00
IGL00902:Akap11 APN 14 78495838 missense probably benign 0.11
IGL01752:Akap11 APN 14 78509878 critical splice donor site probably null
IGL01972:Akap11 APN 14 78507857 missense probably damaging 0.99
IGL02031:Akap11 APN 14 78513813 missense possibly damaging 0.50
IGL02239:Akap11 APN 14 78513849 missense probably damaging 1.00
IGL02528:Akap11 APN 14 78510867 missense probably damaging 1.00
IGL02884:Akap11 APN 14 78498962 missense probably benign 0.02
IGL03130:Akap11 APN 14 78510368 nonsense probably null
IGL03179:Akap11 APN 14 78507740 missense probably benign 0.00
IGL03240:Akap11 APN 14 78495905 missense probably damaging 0.99
IGL03331:Akap11 APN 14 78513865 missense probably damaging 1.00
bonham UTSW 14 78498864 nonsense probably null
R0004:Akap11 UTSW 14 78514940 missense possibly damaging 0.65
R0020:Akap11 UTSW 14 78518177 missense probably benign 0.37
R0200:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0281:Akap11 UTSW 14 78510089 missense possibly damaging 0.84
R0320:Akap11 UTSW 14 78513379 missense probably benign
R0381:Akap11 UTSW 14 78513550 missense probably benign 0.01
R0536:Akap11 UTSW 14 78514024 missense probably damaging 1.00
R0608:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0735:Akap11 UTSW 14 78510078 missense probably damaging 1.00
R1189:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1400:Akap11 UTSW 14 78513962 missense probably damaging 1.00
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1501:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1588:Akap11 UTSW 14 78510245 missense possibly damaging 0.50
R1717:Akap11 UTSW 14 78513348 missense probably benign 0.02
R1823:Akap11 UTSW 14 78511488 missense probably damaging 1.00
R1847:Akap11 UTSW 14 78513661 missense probably benign 0.00
R1874:Akap11 UTSW 14 78511866 missense probably benign 0.14
R2032:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2276:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2763:Akap11 UTSW 14 78518892 missense probably damaging 0.98
R4483:Akap11 UTSW 14 78510259 missense probably damaging 1.00
R4582:Akap11 UTSW 14 78511929 missense possibly damaging 0.81
R4857:Akap11 UTSW 14 78498860 missense
R4922:Akap11 UTSW 14 78512780 nonsense probably null
R4993:Akap11 UTSW 14 78512968 missense probably damaging 1.00
R5426:Akap11 UTSW 14 78498864 nonsense probably null
R5472:Akap11 UTSW 14 78513429 missense probably benign 0.03
R5683:Akap11 UTSW 14 78512578 missense probably damaging 0.98
R5774:Akap11 UTSW 14 78510967 missense probably damaging 1.00
R6014:Akap11 UTSW 14 78512499 missense probably benign 0.00
R6264:Akap11 UTSW 14 78512421 missense possibly damaging 0.68
R6270:Akap11 UTSW 14 78518799 missense probably damaging 1.00
R6319:Akap11 UTSW 14 78513538 missense probably benign 0.06
R6376:Akap11 UTSW 14 78514896 missense probably damaging 1.00
R6394:Akap11 UTSW 14 78522589 critical splice donor site probably null
R6536:Akap11 UTSW 14 78511314 missense possibly damaging 0.81
R7048:Akap11 UTSW 14 78512514 missense
R7147:Akap11 UTSW 14 78511465 missense
R7473:Akap11 UTSW 14 78513888 missense
R7503:Akap11 UTSW 14 78512001 missense
R7542:Akap11 UTSW 14 78510292 missense
R7618:Akap11 UTSW 14 78498860 missense
R7679:Akap11 UTSW 14 78514816 missense
R8094:Akap11 UTSW 14 78512973 missense
R8098:Akap11 UTSW 14 78512922 missense
R8226:Akap11 UTSW 14 78511209 missense
R8269:Akap11 UTSW 14 78513378 missense
R8304:Akap11 UTSW 14 78513232 missense
Predicted Primers PCR Primer
(F):5'- CATACAGGGCAAAGTTAACTCTTC -3'
(R):5'- AGGAATTCCATGGTTGCACC -3'

Sequencing Primer
(F):5'- AAGGCTCTCAGCAAAGCT -3'
(R):5'- GGTTGCACCAGAAATTCTGC -3'
Posted On2014-08-25